|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Oct 24, 2019 |
Title |
EN_11m_4 |
Sample type |
SRA |
|
|
Source name |
endometrium
|
Organism |
Equus caballus |
Characteristics |
Sex: Female tissue: Endometrium of placenta gestational age: 11m
|
Extracted molecule |
total RNA |
Extraction protocol |
Isolation of RNA from tissue was performed using RNeasy Mini Kit (Qiagen, Gaithersburg, MD, USA), per manufacturer’s instructions. After extraction, RNA was analyzed by NanoDrop® (Thermo Fisher Scientific) and Bioanalyzer® (Agilent, Santa Clara, CA, USA) to evaluate concentration, purity and integrity. All samples had a 230/260 ratio > 1.8, a 260/280 ratio > 2.0 and an RNA integrity number > 8.0. Library preparation was performed using the TruSeq Stranded mRNA Sample Prep Kit (Illumina), per manufacturer’s instructions. The adapter for Read 1 was AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG, with NNNNNN signifying the index sequence. The read 2 adapter was AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT. All reads were quantified with qPCR. Sequencing was performed on a HiSeq 4000 (Illumina) using a HiSeq 4000 sequencing kit version 1, generating 150 bp paired-end reads (University of Illinois Roy J. Carver Biotechnology Center). FASTQ files were generated and demultiplexed using bcl2fastq v2.17.1.14 Conversion Software (Illumina).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 4000 |
|
|
Description |
processed data file: processed_data.xlsx
|
Data processing |
The sequencing results were initially trimmed for adapters and quality using TrimGalore Version 0.4.4 (Babraham Bioinformatics; www.bioinformatics.babraham.ac.uk). Mapped to EquCab3.0 using STAR-2.5.2b (github.com/alexdobin/STAR). Cufflinks-2.2.1 (cole-trapnell-lab.github.io/cufflinks/) was used to quantify data in fragments per kilobase/million (FPKM), with the Equus_caballus_Ensembl_95 gtf file used for annotation (-G). Genome_build: EquCab3.0 Supplementary_files_format_and_content: processed_data.xlsx: Excel file includes FPKM values.
|
|
|
Submission date |
Aug 30, 2019 |
Last update date |
Oct 24, 2019 |
Contact name |
Shavahn C Loux |
E-mail(s) |
Shavahn.Loux@uky.edu
|
Organization name |
University of Kentucky
|
Department |
Veterinary Science
|
Street address |
1400 Nicholasville
|
City |
Lexington |
State/province |
KY |
ZIP/Postal code |
40546 |
Country |
USA |
|
|
Platform ID |
GPL24409 |
Series (1) |
GSE136691 |
Characterization of the Placental Transcriptome through Mid to Late Gestation in the Mare |
|
Relations |
BioSample |
SAMN12662419 |
SRA |
SRX6784253 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|