Bacterial cultures were first inoculated from frozen stocks onto King’s Medium B agar (King, et al., 1954) for overnight incubation at 27ºC. This plate was used to inoculate a 5 ml broth culture of nutrient broth amended with 1% glycerol (NBgly) grown shaking at 200 rpm for 16-18 hours at 27ºC. Inoculum was washed in sterile NBgly broth prior to inoculation and resuspended in 20 ml of NBgly broth in a 125 ml erlenmeyer flask to an OD600 of ~0.05. Three replicate cultures were grown with shaking (200 rpm) at 20ºC until harvest at the specified optical density of 0.50. For each replicate culture, RNA was pretreated with RNAProtect (Qiagen, Valencia, CA) for 10 minutes, centrifuged and pellets were stored at -80°C until extracted.
Extracted molecule
total RNA
Extraction protocol
Extractions were done using the RNA/DNA Midi Kit (Qiagen, Valencia, CA) followed by an on-column DNAse treatment (RNeasy Mini Kit with DNAse I; Qiagen, Valencia, CA). PCR was performed on the RNA to determine that detectable DNA had been removed and RNA samples were analyzed for quality using the BioAnalyzer 2100 (Agilent, Palo Alto, CA).
Label
Cy3
Label protocol
Make spike-in control pools from RNA amplified from cloned Arabidopsis thaliana genes (cab, ltp4, rca, rbcL, ltp6, rcp1, nac, xcp2, prk, and tim) using the MegaScript Kit (Ambion) by combining for Cy5 pool: 5.2 microliters 20.3 ng/microliter cab RNA; 12.5 microliters 16.839 ng/microliter ltp4 RNA; 18.6 microliters 22.634 ng/microliter rca RNA; 41.8 microliters 15.068 ng/microliter rbcL RNA; 4.7 microliters 13.279 ng/microliter ltp6 RNA; 11.8 microliters 21.313 ng/microliter rcp1 RNA; 40.7 microliters 23.23 ng/microliter nac RNA; 4.6 microliters 18.177 ng/microliter xcp2 RNA; 14.7 microliters 11.436 ng/microliter prk RNA; 18.9 microliters 11.084 ng/microliter tim RNA; 826.5 microliters water. And for Cy3 pool: 5.2 microliters 20.3 ng/microliter cab RNA; 12.5 microliters 16.839 ng/microliter ltp4 RNA; 18.6 microliters 22.634 ng/microliter rca RNA; 41.8 microliters 15.068 ng/microliter rbcL RNA; 1.6 microliters 13.279 ng/microliter ltp6 RNA; 3.9 microliters 21.313 ng/microliter rcp1 RNA; 13.6 microliters 23.23 ng/microliter nac RNA; 13.9 microliters 18.177 ng/microliter xcp2 RNA; 44.1 microliters 11.436 ng/microliter prk RNA; 56.8 microliters 11.084 ng/microliter tim RNA; 788.1 microliters water. To label RNA sample combine: 4 micrograms RNA; 2 microliters 3 mg/mL random hexamers (Invitrogen); 2 microliters arabidopsis spike-in control RNA; DEPC water to a final volume to 17.5 microliters. Mix and incubated at 70 degrees C for 10 minutes. Snap-freeze in dry ice/ethanol for 30 seconds and centrifuged for 1 minute at approximately 16,000g. Add: 6 microliters 5X Superscript II buffer (Invitrogen); 3 microliters 0.1 M dithiothreitol; 1.2 microliters aminoallyl-dNTP mix containing 12.5 mM dATP, 12.5 mM dCTP, 12.5 mM dGTP, 4.16 mM dTTP, and 8.33 mM aadUTP; 2 microliters SuperScript II (Invitrogen). Mix and incubated overnight at 42 degrees C. Add: 10 microliters 1 M NaOH; 10 microliters 0.5 M EDTA. Incubate for 15 minutes at 65 degrees C. Add: 25 microliters 1 M Tris pH 7.4; 400 microliters PB buffer (Qiagen). Apply sample to QIAquick column (Qiagen). Centrifuge for 1 minute at 15,000g. Wash with 750 microliters phosphate wash buffer (84.25 mL 95% EtOH + 15.25 mL water + 0.5 mL 1 M KPO4 pH 8.5 solution made by combining 0.5 mL 1M KH2PO4 with 9.5 mL 1M K2HPO4). Centrifuge for 1 minute at 15,000g. Repeat wash. Empty collection tube and centrifuge for 1 minute at 15,000g. Transfer column to fresh tube. Add 30 microliters phosphate elution buffer (4 mM KPO4 solution made by diluting 1 M KPO4 pH 8.5 solution). Incubate for 1 minute. Centrifuge for 1 minute at 15,000g. Repeat elution for a final volume of 60 microliters. Dry sample using a speed vac. Resuspend cDNA in 4.5 microliters 0.1 M carbonate buffer (1 M Na2CO3 buffer pH 9.0 diluted 1:10 with water). Allow the sample to resuspend for 15 minutes at room temperature. Add 4.5 microliters NHS-Cy (Amersham) resuspended in 73 microliters DMSO. Incubate for 1 hour at room temperature in the dark. Add 4.5 microliters 4 M hydroxylamine. Incubate for 15 minutes at room temperature in the dark. Add: 35 microliters 100 mM NaOAc pH 5.2; 500 microliters PB buffer. Apply to Qiaquick column. Centrifuge for 1 minute at 15,000g. Wash with 750 microliters PE buffer (Qiagen). Centrifuge for 1 minute at 15,000g. Repeat wash. Empty collection tube and centrifuge for 1 minute at 15,000g. Transfer column to fresh tube. Add 30 microliters EB buffer (Qiagen). Incubate for 1 minute. Centrifuge for 1 minute at 15,000g. Repeat elution for a final volume of 60 microliters. Check quality of probes spectrophotometrically from 200nm to 700nm. Store at -80 degrees C. Use this protocol to label 12 ug RNA and combine products for one hyb.
Bacterial cultures were first inoculated from frozen stocks onto King’s Medium B agar (King, et al., 1954) for overnight incubation at 27ºC. This plate was used to inoculate a 5 ml broth culture of nutrient broth amended with 1% glycerol (NBgly) grown shaking at 200 rpm for 16-18 hours at 27ºC. Inoculum was washed in sterile NBgly broth prior to inoculation and resuspended in 20 ml of NBgly broth in a 125 ml erlenmeyer flask to an OD600 of ~0.05. Three replicate cultures were grown with shaking (200 rpm) at 20ºC until harvest at the specified optical density of 0.47. For each replicate culture, RNA was pretreated with RNAProtect (Qiagen, Valencia, CA) for 10 minutes, centrifuged and pellets were stored at -80°C until extracted.
Extracted molecule
total RNA
Extraction protocol
Extractions were done using the RNA/DNA Midi Kit (Qiagen, Valencia, CA) followed by an on-column DNAse treatment (RNeasy Mini Kit with DNAse I; Qiagen, Valencia, CA). PCR was performed on the RNA to determine that detectable DNA had been removed and RNA samples were analyzed for quality using the BioAnalyzer 2100 (Agilent, Palo Alto, CA).
Label
cy5
Label protocol
Make spike-in control pools from RNA amplified from cloned Arabidopsis thaliana genes (cab, ltp4, rca, rbcL, ltp6, rcp1, nac, xcp2, prk, and tim) using the MegaScript Kit (Ambion) by combining for Cy5 pool: 5.2 microliters 20.3 ng/microliter cab RNA; 12.5 microliters 16.839 ng/microliter ltp4 RNA; 18.6 microliters 22.634 ng/microliter rca RNA; 41.8 microliters 15.068 ng/microliter rbcL RNA; 4.7 microliters 13.279 ng/microliter ltp6 RNA; 11.8 microliters 21.313 ng/microliter rcp1 RNA; 40.7 microliters 23.23 ng/microliter nac RNA; 4.6 microliters 18.177 ng/microliter xcp2 RNA; 14.7 microliters 11.436 ng/microliter prk RNA; 18.9 microliters 11.084 ng/microliter tim RNA; 826.5 microliters water. And for Cy3 pool: 5.2 microliters 20.3 ng/microliter cab RNA; 12.5 microliters 16.839 ng/microliter ltp4 RNA; 18.6 microliters 22.634 ng/microliter rca RNA; 41.8 microliters 15.068 ng/microliter rbcL RNA; 1.6 microliters 13.279 ng/microliter ltp6 RNA; 3.9 microliters 21.313 ng/microliter rcp1 RNA; 13.6 microliters 23.23 ng/microliter nac RNA; 13.9 microliters 18.177 ng/microliter xcp2 RNA; 44.1 microliters 11.436 ng/microliter prk RNA; 56.8 microliters 11.084 ng/microliter tim RNA; 788.1 microliters water. To label RNA sample combine: 4 micrograms RNA; 2 microliters 3 mg/mL random hexamers (Invitrogen); 2 microliters arabidopsis spike-in control RNA; DEPC water to a final volume to 17.5 microliters. Mix and incubated at 70 degrees C for 10 minutes. Snap-freeze in dry ice/ethanol for 30 seconds and centrifuged for 1 minute at approximately 16,000g. Add: 6 microliters 5X Superscript II buffer (Invitrogen); 3 microliters 0.1 M dithiothreitol; 1.2 microliters aminoallyl-dNTP mix containing 12.5 mM dATP, 12.5 mM dCTP, 12.5 mM dGTP, 4.16 mM dTTP, and 8.33 mM aadUTP; 2 microliters SuperScript II (Invitrogen). Mix and incubated overnight at 42 degrees C. Add: 10 microliters 1 M NaOH; 10 microliters 0.5 M EDTA. Incubate for 15 minutes at 65 degrees C. Add: 25 microliters 1 M Tris pH 7.4; 400 microliters PB buffer (Qiagen). Apply sample to QIAquick column (Qiagen). Centrifuge for 1 minute at 15,000g. Wash with 750 microliters phosphate wash buffer (84.25 mL 95% EtOH + 15.25 mL water + 0.5 mL 1 M KPO4 pH 8.5 solution made by combining 0.5 mL 1M KH2PO4 with 9.5 mL 1M K2HPO4). Centrifuge for 1 minute at 15,000g. Repeat wash. Empty collection tube and centrifuge for 1 minute at 15,000g. Transfer column to fresh tube. Add 30 microliters phosphate elution buffer (4 mM KPO4 solution made by diluting 1 M KPO4 pH 8.5 solution). Incubate for 1 minute. Centrifuge for 1 minute at 15,000g. Repeat elution for a final volume of 60 microliters. Dry sample using a speed vac. Resuspend cDNA in 4.5 microliters 0.1 M carbonate buffer (1 M Na2CO3 buffer pH 9.0 diluted 1:10 with water). Allow the sample to resuspend for 15 minutes at room temperature. Add 4.5 microliters NHS-Cy (Amersham) resuspended in 73 microliters DMSO. Incubate for 1 hour at room temperature in the dark. Add 4.5 microliters 4 M hydroxylamine. Incubate for 15 minutes at room temperature in the dark. Add: 35 microliters 100 mM NaOAc pH 5.2; 500 microliters PB buffer. Apply to Qiaquick column. Centrifuge for 1 minute at 15,000g. Wash with 750 microliters PE buffer (Qiagen). Centrifuge for 1 minute at 15,000g. Repeat wash. Empty collection tube and centrifuge for 1 minute at 15,000g. Transfer column to fresh tube. Add 30 microliters EB buffer (Qiagen). Incubate for 1 minute. Centrifuge for 1 minute at 15,000g. Repeat elution for a final volume of 60 microliters. Check quality of probes spectrophotometrically from 200nm to 700nm. Store at -80 degrees C. Use this protocol to label 12 ug RNA and combine products for one hyb.
Hybridization protocol
Combine Cy3 and Cy5 samples and 1 microliter cy-labeled arabidopsis 70-mer positional controls (This is a pool of 4 70-mers labeled with Cy3 and Cy5 for a total of 8 70-mers at 2 ng/microliter each. The sequences are: At2g14610a_219_rev - AAAAAAATATATCAACAATGGCAAAGCTACCGATACGAAACAATATTAGGAAAAATGTGTGTAAGGACAA; At2g14610b_265_rev - AATTTAAACTGCGTATTAGTGTTTGGAAAAAAAAAACAAAGTGTATACAATGTCAATCGGTGATCTTTTT; At2g14610c_305_rev - TTAATAACATATAATATTGAATAGGATATCATAGGATATTATTACGTAATAATATCCTATGGTGTCATTT; At2g14610d_298_rev - CGACTTTTCTTGCTTAGAAGTCTTTGCATTGTTAATAGATTGTTGAAAAGGTTTATTCATTACTTTCATG). Dry using a speed vac. Make pre-hybridization buffer by combining: 0.5 g BSA; 37 mL DEPC water; 12.5 mL 20X SSC; 0.5 mL 10% SDS. Incubate pre-hybridization buffer for 20 minutes at 42 degrees C. Filter using a 0.45 micrometer cellulose acetate filter into a coplin jar. Incubate for 20 minutes at 42 degrees C. Make hybridization buffer by combining: 500 microliters fomamide; 250 microliters 20X SSC; 10 microliters 10% SDS; 240 microliters DEPC water. Filter hybridization buffer through a 0.45 micrometer cellulose acetate filter. Add 50 uL sheared salmon sperm DNA (Ambion) to hybridization buffer. Add 60 microliters hybridization buffer to speed vac-dried probes. Put slide into pre-hybridization buffer in coplin jar. Incubate for 45 minutes at 42 degrees C. Wash slide 4 times in water and 3 times in isopropanol for 2 minutes per wash with gentle shaking by hand. Dry slide by spinning. Clean 25 mm x 60 mm lifterslip (Erie Scientific Company) by dipping in MilliQ water for 5 minutes at room temperature. Dip in 100% EtOH and dry with a Chem Wipe. Heat probes for 15 minutes at 95 degrees C with occassional "flicking" to resuspend probes. Remove probes from heat block and centrifuge for 2 minutes at 15,000g. Place lifterslip onto slide and add probes by allowing capillary action to pull the probes under the lifterslip. Hybridize overnight at 42 degrees C. Wash slide 2 times in glass staining dish with 1X SSC, 0.2% SDS for 5 minutes at 42 degrees C. Wash slide in 0.1X SSC, 0.1% SDS for 5 minutes at room temperature. Wash slide 3 times in 0.1X SSC for 5 minutes at room temperature. Dry slide by spinning.
Scan protocol
Slides were scanned at 10 micrometer resolution using an Axon 4000B scanner with GenePix 4.0 software.
Description
This slide measures gene expression of a gacA mutant as compared to wild type. The gacA mutant of Pf-5 was constructed by replacing 626 bp internal to gacA with aphI, which confers kanamycin resistance.
Data processing
Tiff images were processed using TIGR-Spotfinder (www.tigr.org/software) with Otsu thresholding, a minimum spot size of 10 and a maximum spot size of 15, and applying the default quality control filter options. The data were normalized ignoring controls with the LOWESS algorithm in block mode with a smooth parameter of 0.33 by using TIGR-MIDAS (www.tigr.org/software).
Inactivation of the GacA response regulator in Pseudomonas fluorescens Pf-5 has far-reaching transcriptomic consequences
Data table header descriptions
ID_REF
channel_A_cy3
spot intensity in channel A (cy3) corrected for background
channel_B_cy5
spot intensity in channel B (cy5) corrected for background
VALUE
log ratio of LOWESS-normalized channel intensities - log2(experimental channel/reference channel)
area
spot total area in pixels
saturation_factor
spot saturation factor - percentage of nonsaturated pixels in spot
median_ratio
spot median ratio
mode_ratio
spot mode ratio
channel_A_background
spot background in channel A
channel_B_background
spot background in channel B
channel_A_flag
spot flag in channel A: A - number of non-saturated pixels in spot is less than 30; B - number of non-saturated pixels in spot is between 30 and 50; C - number of non-saturated pixels in spot is more than 50; S - fully or partially saturated spot; X - spot was detected and rejected based on spot shape and spot intensity relative to surrounding background; Z - spot was not detected by the program; Y - spot background is higher than spot intensity
channel_B_flag
spot flag in channel B: A - number of non-saturated pixels in spot is less than 30; B - number of non-saturated pixels in spot is between 30 and 50; C - number of non-saturated pixels in spot is more than 50; S - fully or partially saturated spot; X - spot was detected and rejected based on spot shape and spot intensity relative to surrounding background; Z - spot was not detected by the program; Y - spot background is higher than spot intensity
channel_A_QC
spot QC score in channel A - This is a geometric mean of shape and S/N QC scores in the channel A. S/N QC score is calculated as percentage of pixels in a spot with values higher than 2*median(local BKG). Spot shape QC score is defined as ratio of spot area to spot perimeter scaled into the range between 0 and 1.
channel_B_QC
spot QC score in channel B - This is a geometric mean of shape and S/N QC scores in the channel B. S/N QC score is calculated as percentage of pixels in a spot with values higher than 2*median(local BKG). Spot shape QC score is defined as ratio of spot area to spot perimeter scaled into the range between 0 and 1.
mean_QC
spot total QC score - This is the mean of scores in channels A and B.
