|
Status |
Public on Nov 11, 2019 |
Title |
Donor-blunt Acceptor-N |
Sample type |
SRA |
|
|
Source name |
Integrated DNA technologies
|
Organism |
synthetic construct |
Characteristics |
starter molecule: blunt end R2 RNA/ R2R DNA duplex acceptor: 50 nt RNA oligonucleotide with 3' equimolar N
|
Extracted molecule |
total RNA |
Extraction protocol |
N/A; synthetic oligonucleotdes RNA sequencing libraries were prepared by using TGIRT-III (InGex), a commercial version of GsI-IIC RT, with different R2 RNA/R2R starter duplexes and acceptor nucleic acids as indicated in the text. The initial template template-switching reactions for addition of the R2R adapter to the 5' end of the cDNA were done as described above with 500 nM TGIRT-III enzyme, 50 nM unlabeled starter duplex, and 100 nM acceptor RNA for 15 min at 60 °C. After terminating the reactions with NaOH and neutralization with HCl as described above for template-switching reactions, the volume was raised to 100 μl with H2O, and cDNA products containing the R2R adapter attached to their 5' end were cleaned-up by using a MinElute column (Qiagen) to remove unused primer. A 5’ adenylated R1R adapter was then ligated to the 3' end of the cDNA using Thermostable 5’ AppDNA/RNA ligase (New England Biolabs) for 1 h at 65 °C. After another MinElute clean up, the entirety of the eluent was used for a 12 cycle PCR reaction using Phusion polymerase (ThermoFisher), and the resulting libraries were cleaned up by using 1.4x Ampure XP beads to remove residual primers, primer dimers, salts, and enzymes. The quality of the libraries was assessed by using a 2100 Bioanalzyer Instrument (Agilent) with a High Sensitivity DNA chip (Agilent). The libraries were sequenced on an Illumina NextSeq instrument to obtain 1-2 million 75-nt paired-end reads. Read 1 was used for analysis.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
synthetic oligonucleotide
|
Data processing |
Library strategy: TGIRT-seq reads from each dataset were trimmed from the 5’ end using Cutadapt v2.5 to re-move all but the last 3 nucleotides of the 5’ acceptor (GAC) by using the following pa-rameters: cutadapt -O 10 --nextseq-trim=20 --trim-n -q 20 --discard-untrimmed -g CGCCGGACCGTGCACCATCTGGAGTTATAGAGATGAGTCTCACATA -j 8 -e 0.1 -o {Step1 trimmed reads} {Read 1 file} reads were then trimmed from the 3’ end to leave the junction sequences flanked by GAC at the 5’ end and CGC (acceptor) or AGA (donor) at the 3’ end by using the following parameters: cutadapt -O 10 --nextseq-trim=20 --trim-n -q 20 --discard-untrimmed -a CGGACCGTGCACCAT -a TCGGAAGAGCACACG -j 8 -e 0.1 -o {Step2 trimmed reads} {Step1 trimmed reads} trimmed reads containing either acceptor-donor junction 5’-GAC-(N)n-AGA-3’ or ac-ceptor- acceptor junction 5’-GAC-(N)n-CGC-3’ were then binned and counted Genome_build: N/A Supplementary_files_format_and_content: count of junction reads
|
|
|
Submission date |
Sep 30, 2019 |
Last update date |
Nov 12, 2019 |
Contact name |
Alan Lambowitz |
E-mail(s) |
lambowitz@austin.utexas.edu
|
Phone |
512-232-3418
|
Organization name |
University of Texas at Austin
|
Street address |
2500 Speedway
|
City |
Austin |
State/province |
TX |
ZIP/Postal code |
78712 |
Country |
USA |
|
|
Platform ID |
GPL19424 |
Series (1) |
GSE138200 |
Template switching by a group II intron reverse transcriptase: biochemical analysis and implications for RNA-seq |
|
Relations |
BioSample |
SAMN12875776 |
SRA |
SRX6925992 |