NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4110083 Query DataSets for GSM4110083
Status Public on Apr 25, 2020
Title GT_E17_5_H3K27ac
Sample type SRA
 
Source name genital tubercule
Organism Mus musculus
Characteristics tissue: genital tubercle
antibody: H3K27ac
genotype: wild type
developmental stage: E17.5
strain: CBA / C57BL/6 mix
Extracted molecule genomic DNA
Extraction protocol Micro-dissected GT (35 to 40) or CR (70) were crosslinked in 1% formaldehyde/PBS for 20 min and stored at -80oC until further processing. Chromatin was sheared using a water-bath sonicator (Covaris E220 evolution ultra-sonicator). Immunoprecipitation was done using the following antibodies, anti-CTCF (Active Motif, 61311), anti- H3K27ac (Abcam, ab4729), and H3K27me3 (Merck Millipore, 07-449)
Libraries were prepared using the TruSeq protocol, and sequenced on the Illumina HiSeq system (100bp single-end reads) according to manufactures instructions.
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model Illumina HiSeq 2500
 
Data processing ChIP-seq reads processing was done on the Duboule lab local Galaxy server (Afgan et al., 2016). Adapters and bad-quality bases were removed with Cutadapt version 1.16 (Martin, 2011) (options -m 15 -q 30 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC). Reads were mapped to the mouse genome (mm10) using Bowtie2 (v2.3.4.1) (Langmead and Salzberg, 2012), with standard settings. The coverage was obtained as the output of MACS2 (v2.1.1.20160309) (Zhang et al., 2008). Peak calling in Figure 5 was done using MACS2 (v2.1.0.20160309) callpeak (--gsize 1870000000) using the corresponding input data as control BAM (-c).
Genome_build: mm10
 
Submission date Oct 07, 2019
Last update date Apr 26, 2020
Contact name Ana Rita Amandio Lhopitallier
E-mail(s) rita.lhopitallier@epfl.ch
Organization name EPFL
Department SV-ISREC-EPFL
Lab Laboratory of Developmental Genomics
Street address SV2842, Station 19
City Lausanne
ZIP/Postal code CH-1015
Country Switzerland
 
Platform ID GPL17021
Series (2)
GSE138509 A complex regulatory landscape involved in the development of external genitals [ChIP-Seq]
GSE138514 A complex regulatory landscape involved in the development of external genitals
Relations
BioSample SAMN12983219
SRA SRX6958323

Supplementary file Size Download File type/resource
GSM4110083_GT_E17_5_H3K27ac.bedgraph.gz 306.8 Mb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap