 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 25, 2020 |
| Title |
GT_E13_5_Input |
| Sample type |
SRA |
| |
|
| Source name |
genital tubercule
|
| Organism |
Mus musculus |
| Characteristics |
tissue: genital tubercle
antibody: none
genotype: wild type
developmental stage: E13.5
strain: CBA / C57BL/6 mix
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Micro-dissected GT (35 to 40) or CR (70) were crosslinked in 1% formaldehyde/PBS for 20 min and stored at -80oC until further processing. Chromatin was sheared using a water-bath sonicator (Covaris E220 evolution ultra-sonicator). Immunoprecipitation was done using the following antibodies, anti-CTCF (Active Motif, 61311), anti- H3K27ac (Abcam, ab4729), and H3K27me3 (Merck Millipore, 07-449)
Libraries were prepared using the TruSeq protocol, and sequenced on the Illumina HiSeq system (100bp single-end reads) according to manufactures instructions.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
ChIP-seq reads processing was done on the Duboule lab local Galaxy server (Afgan et al., 2016). Adapters and bad-quality bases were removed with Cutadapt version 1.16 (Martin, 2011) (options -m 15 -q 30 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC). Reads were mapped to the mouse genome (mm10) using Bowtie2 (v2.3.4.1) (Langmead and Salzberg, 2012), with standard settings. The coverage was obtained as the output of MACS2 (v2.1.1.20160309) (Zhang et al., 2008). Peak calling in Figure 5 was done using MACS2 (v2.1.0.20160309) callpeak (--gsize 1870000000) using the corresponding input data as control BAM (-c).
Genome_build: mm10
|
| |
|
| Submission date |
Oct 07, 2019 |
| Last update date |
Apr 26, 2020 |
| Contact name |
Ana Rita Amandio Lhopitallier |
| E-mail(s) |
rita.lhopitallier@epfl.ch
|
| Organization name |
EPFL
|
| Department |
SV-ISREC-EPFL
|
| Lab |
Laboratory of Developmental Genomics
|
| Street address |
SV2842, Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
CH-1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE138509 |
A complex regulatory landscape involved in the development of external genitals [ChIP-Seq] |
| GSE138514 |
A complex regulatory landscape involved in the development of external genitals |
|
| Relations |
| BioSample |
SAMN12982915 |
| SRA |
SRX6958327 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4110087_GT_E13_5_Input.bedgraph.gz |
178.1 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
