GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4221104

Query DataSets for GSM4221104

Status

Public on Dec 17, 2019

Title

38-6 1h

Sample type

SRA

Source name

synthetic construct

Organism

synthetic construct

Characteristics

sample type: RNA polymerase ribozyme products

Extracted molecule

total RNA

Extraction protocol

Hammerhead ribozyme RNA was synthesized from a corresponding template RNA, a biotinylated RNA primer and the 24-3 or 38-6 RNA polymerase ribozymes at concentrations of 100 nM, 80 nM, and 100 nM, respectively, in a reaction mixture containing 4 mM each NTP, 200 mM MgCl2, 25 mM Tris-HCl (pH 8.3), and 0.05% Tween-20, which was incubated at 17 °C for 24 h for 24-3 and 1 h for 38-6. Extended RNA primers were captured on MyOne Streptavidin C1 dynabeads, washed to remove RNA template and polymerase ribozyme, and recovered by heating in 95% formamide and 10 mM EDTA at 95 °C for 10 min, then ethanol precipitated.
The purified RNAs were ligated to the NEB Universal miRNA cloning linker using K227Q T4 RNA ligase 2 according to the manufacturer protocols, reverse transcribed using Superscript IV (ThermoFisher), and the cDNA poly(C)-tailed using Terminal Transferase and a standard protocol (New England Biolabs). All enzymes were heat inactivated at 80 °C for 20 min, prior to library construction from cDNA by nested PCR using the Q5 Hot-Start High Fidelity DNA Polymerase (New England Biolabs), first using primers complementary to the constant flanking regions of the cDNA to append Illumina adapter sequences, then using Illumina Nextera primers to add index sequences (503 for both, 701 and 702 for 24-3 and 38-6 samples, respectively). 150-250nt PCR products were isolated by agarose gel and purified by the PureLink Gel Purification Kit (ThermoFisher) prior to sequencing.
Library was composed of two constant regions flanking the variable length and sequence products from the RNA polymerization reactions: 5'-CTACAGGGCACTCCACAC - X - CTGTAGGCACCATCAAT-3', where X is variable, but would be 5' - GACGTACTGATGAGGCCGAAAGGCCGAAAAGCGTTTTTTGTCATTGTC - 3' if the RNA template was copied accurately and completely. Adapter and index sequences were appended to the 5'- and 3'- ends as described in the library construction protocol.

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina MiniSeq

Data processing

Library strategy: RNA primer extension
Reads were trimmed using cutadapt(1) v2.4 with parameters --trimmed-only -e 0.25 --pair-filter both -n 2 -j 2 -a CTGTAGGCACCATCAATCTGTCTCTTATACACATCTCCGAGCCC -G ATTGATGGTGCCTACAG -A CTGTCTCTTATACACATCTGACGCTGCCGACGA.
The sequences without barcodes were filtered out with cutadapt -g CTACAGGGCACTCCACAC --action none -discard-untrimmed -e 0.05 --pair-filter both -n 1 -j 2.
Next, paired reads were combined into transFrags using FLASH(2) v1.2.11 with parameters -t 1 -m 4 -M 48 -x 0.3.
Tranfrags were filtered for quality using fastq_quality_filter from FASTX Toolkit(3) v0.0.13. With -Q33 -q 30 -p 100 to ensure only high quality reads were kept.
Then, bowtie2(4) was used to align the transFrags to the template sequence (containing both constant regions) using parameters --end-to-end -L 5 --reorder. Resulting sam files were converted to sorted indexed bam files using samtools(5) v1.9.
Afterward, breseq(6) bamtoaln (v 0.27.0) was used to produce a gapped alignment of the reads to the template sequence with format txt and -n 2000000 (to ensure all reads were aligned).
Finally, a custom java script (Supplemental File X) was used to calculate the number of matches, mismatches, deletions, and insertions as a function of template position and read length class. The script was compiled after extracting the java files using javac v1.7 (Oracle Inc.), and run with java using the output tables from breseq bamtoaln and a template length of 83.
Resulting tables were manually processed to produce position-specific and length-specific plots and analyses.
Genome_build: Synthetic construct
Supplementary_files_format_and_content: Excel Spreadsheet with statistics and plots

Submission date

Dec 16, 2019

Last update date

Mar 28, 2022

Contact name

April Elizabeth Williams

E-mail(s)

apriljack06@gmail.com, awilliams@salk.edu

Phone

7345461645

Organization name

Salk Institute for Biological Studies