 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 29, 2021 |
| Title |
RR724_mix_input_total RNA |
| Sample type |
SRA |
| |
|
| Source name |
equimolar_mixed_RNA
|
| Organisms |
Caenorhabditis elegans; Bombyx mori; Mus musculus |
| Characteristics |
purification: input
tissue: adult worm, adult mouse testes and Bombyx mori BmN4-SID1 insect cell line
genotype: WT
growth plate: n.a.
|
| Growth protocol |
To be able to compare the m6A levels between the species, the total or poly(A)+ RNA was isolated from the adult worm, mouse testis (P30) and bombyx cell line (BmN4-SID1), mixed in equal amounts and used for m6A IP-Seq. To identify the transcripts whose m6A methylation is performed by METT-10, we compared the m6A levels in the Mett-10 WT and Mett-10 KO worms by m6A-IP followed by RNA-Seq. The mett-10 knockout strain, VC1743 was obtained from the CGC. All of the C. elegans experiments and worm maintenance was carried at 20°C. To identify the effect of the diet, the worms were fed on one of the two E. coli bacteria strains, OP50 or NA22, grown on standard (OP50) or peptone-rich (NA22) plates.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Comparison of mouse and worm m6A distribution: PolyA+ transcripts were purified from 75 µg of total RNA using the Dynabeads mRNA purification kit (Life Technologies; cat. no 61006). An equal amount (in µg) of total or polyA+ RNA from adult mouse testes and Bombyx mori BmN4-SID1 insect cell line were mixed together with worm polyA+ or total RNA prior to subsequent processing. In this mixed sample, the mouse RNA serves as an internal control for efficient m6A immunoprecipitation via the unambiguous detection of m6A peaks that are already reported. Fragmentation for total or Poly(A)+ RNA mixture from mouse, worm and BmN4-SID1 was performed as described (Wojtas, M. N. et al.,Mol. Cell 68, 374–387 (2017). For total RNA fragmentation; 5µg of total RNA from mouse testis, adult worms and BmN4-SID1 cells each were used. For polyA+ RNA fragmentation, 2µg of poly(A)+ selected RNA from mouse testis, adult worms and BmN4-SID1 cells each was fragmented. Denaturing urea-PAGE confirmed that the majority of the RNA fragments were in size range of 20-80 nucleotides. A small portion (10%) of fragmented RNA was kept aside to be used as the input sample, while the remainder was subjected to immunoprecipitation. The m6A immunoprecipitation was performed as described (Wojtas, M. N. et al.,Mol. Cell 68, 374–387 (2017).
Comparison of m6A distribution between mett-10 KO and mett-10 WT worms: Total RNA was isolated from adult wildtype or Mettl16 (Mett-10) mutant worms (C. elegans), grown on different media, using the Trizol reagent (ThermoFisher Scientific; 15596026). Poly(A)+ transcripts were Comparison of m6A distribution between mett-10 KO and mett-10 WT worms: purified from 75 µg of total RNA using the Dynabeads mRNA purification kit (Life Technologies; cat. no 61006). Poly(A)+ RNAs (2.50 µg) fragmentation and m6A-IP were carried out as described before (Wojtas, M. N. et al.,Mol. Cell 68, 374–387 (2017).
Strand specific RNA libraries from the input and the m6A IP RNA were prepared using NEBNext® Multiplex Small RNA Library Prep Set for Illumina® (NEB; catalogue No. E7560L) following the manufacturer’s instructions. The libraries were resolved on 3% high-resolution MethaPhor agarose (Lonza; catalog. No. 50180) gels in 1X TAE buffer at 70 V. Fragments in the size-range of ~150-250 bp were gel-extracted with the use of MinElute Gel Extraction Kit (Qiagen; cat No. 28604). Multiple libraries with different barcodes (at 3′ end) were mixed in equimolar ratios and sequenced in EMBL Gene Core facility, Heidelberg or by iGE3 Genomics Platform, University of Geneva.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
MSPC_peaks.xlsx.gz
|
| Data processing |
Comparison of mouse and worm m6A distribution: The reads were sorted into individual libraries based on the barcodes and clipped using cutadapt (parameters: -a AGATCGGAAGAGCACACGTCT -m 15 -e 0.2 -O 4 -q 10 --match-read-wildcards). The clipped reads were aligned to the mouse (GRCm38 – Ensembl release 95) or worm (WBcel235 – Ensembl release 95) genome using STAR (parameters: --outFilterType BySJout --limitOutSJcollapsed 50000000 --limitIObufferSize 1500000000). The m6A peak calling was done separately for reads mapped to mouse or worm genome using MACS2 (macs2 callpeak -f BAM -q 0.01 --nomodel --extsize 50 --call-summits). Consensus peaks from the biological replicates were identified using MSPC (parameters: -r bio -w 1e-4 -s 1e-8).
Comparison of m6A distribution between mett-10 KO and mett-10 WT worms: The reads were sorted into individual libraries based on the barcodes and clipped using cutadapt (parameters: -a AGATCGGAAGAGCACACGTCT -m 15 -e 0.2 -O 4 -q 10 --match-read-wildcards). The clipped reads were aligned to worm transcripts (WBcel235 – Ensembl release 95) using bowtie (parameters: -v 0 -a -k 10 --allow-contain). The read counts were divided by number of transcripts they mapped to and the counts were summarized to gene levels. To find the genes whose transcripts lose m6A methylation in the absence of Mett-10 we looked for genes with significant (padj <=0.1) decrease of m6A-IP/input ratio in Mett-10 KO using DESeq2 likelihood ratio test (LRT) where we compared the full model (~input_or_m6A_IP + genotype + input_or_m6A_IP:genotype) to the reduced model (~input_or_m6A_IP + genotype). To analyze the effect on m6A distribution, we aligned the reads to the genome (WBcel235 – Ensembl release 95) using STAR (parametres: --outFilterType BySJout –limitBAMsortRAM = 40000000000 --outSAMattributes All) and obtained the coverages along the genomic loci.
Genome_build: mouse (GRCm38 – Ensembl release 95) or worm (WBcel235 – Ensembl release 95)
Supplementary_files_format_and_content: The bigWig files contain the genomic coverages for individual samples separately for + and - DNA strand. The DESeq2 csv files contain the gene statistics for m6A-IP/input comparisons between the mett-10 KO and WT. The xlsx file contains the list of identified m6A peaks together with their annotation.
|
| |
|
| Submission date |
Mar 12, 2020 |
| Last update date |
Apr 29, 2021 |
| Contact name |
Ramesh Pillai |
| E-mail(s) |
ramesh.pillai@unige.ch
|
| Organization name |
University of Geneva
|
| Department |
Department of Molecular Biology
|
| Street address |
30, Quai Ernest-Ansermet
|
| City |
Gneveva |
| ZIP/Postal code |
CH-1211 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL28266 |
| Series (1) |
| GSE146873 |
RNA m6A methylation of 3ʹ splice site prevents binding of U2AF35 to inhibit splicing |
|
| Relations |
| BioSample |
SAMN14365469 |
| SRA |
SRX7900183 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4408142_mouse_minus_RR724_Aligned.sortedByCoord.out.bw |
72.8 Mb |
(ftp)(http) |
BW |
| GSM4408142_mouse_plus_RR724_Aligned.sortedByCoord.out.bw |
73.2 Mb |
(ftp)(http) |
BW |
| GSM4408142_worm_minus_RR724_Aligned.sortedByCoord.out.bw |
43.1 Mb |
(ftp)(http) |
BW |
| GSM4408142_worm_plus_RR724_Aligned.sortedByCoord.out.bw |
43.9 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
