|
| Status |
Public on Sep 01, 2020 |
| Title |
mimic_451a_3: SNU478 mimic-451a 3 |
| Sample type |
RNA |
| |
|
| Source name |
CCA cell line SNU478 mimic-451a transfected
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: SNU478
cell type: cholangiocarcinoma
genotype/variation: mimic-451a
|
| Treatment protocol |
Cells were transfected with miRNA mimics of miR-451a (5'AAACCGUUACCAUUACUGAGUU3´) or AllStars control both provided by Qiagen using Lipofectamine RNAiMAX (ThermoFisher).
|
| Growth protocol |
SNU478 cells were cultivated in RPMI 1640 medium (Sigma-Aldrich) supplemented with 10% fetal bovine serum (ThermoFisher) and 1% penicillin/streptomycin (Thermo Fisher).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA from cell lines was isolated with TRIzol Reagent (ThermoFisher).
|
| Label |
biotin
|
| Label protocol |
Biotinylated cDNA were prepared according to the standard Affymetrix protocol.
|
| |
|
| Hybridization protocol |
Hybridization (16h x 45°C) was processed according to the standard Affymetrix protocol.
|
| Scan protocol |
Affymetrix GeneArray Scanner3000
|
| Description |
SNU478 mimic-451a transfected
|
| Data processing |
The data were analyzed with a commercial software called JMP Genomics, version 6, from SAS. Gene expression profiling was performed using arrays of human Clariom D type from Affymetrix. A Custom CDF Version 21 with Entrez based gene definitions was used to annotate the arrays. The Raw fluorescence intensity values were normalized applying quantile normalization, Kernel Surface background correction and Medianpolish Probeset Summary
|
| |
|
| Submission date |
Apr 02, 2020 |
| Last update date |
Sep 02, 2020 |
| Contact name |
Carolina Delatorre |
| E-mail(s) |
carolina.delatorre@medma.uni-heidelberg.de
|
| Organization name |
University Heidelberg
|
| Street address |
Theodor-Kutzer-Ufer 1-3
|
| City |
Mannheim |
| ZIP/Postal code |
68167 |
| Country |
Germany |
| |
|
| Platform ID |
GPL26356 |
| Series (1) |
| GSE147969 |
miRNA profiling of biliary intraepithelial neoplasia reveals step-wise tumorigenesis in distal cholangiocarcinoma via the miR-451a/ATF2 axis |
|
