 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 22, 2020 |
| Title |
HIV_3UTR |
| Sample type |
SRA |
| |
|
| Source name |
in vitro transcribed
|
| Organism |
Human immunodeficiency virus |
| Characteristics |
sample type: in vitro transcribed
library type: pooled
adapter strategy: PCR
rna modification: Methylation
|
| Treatment protocol |
12.5 pmol of RNA was heated at 95 °C for 2 min; cooled on ice for 1 min; then incubated in 300 mM Na-cacodylate, pH 7.0, 10 mM MgCl2 at 37 °C for 30 min at a final volume of 25 μL. Modification conditions used were 0.17 M of dimethyl sulfate at 37 °C for 6 min. RNAse free water was added instead as a no modification control. DMS reactions were quenched with 25 μL of β-mercaptoethanol.
|
| Growth protocol |
RNA was transcribed using DNA templates containing a T7 RNA Polymerase promoter sequence at their 5´ ends and a 20 base-pair Tail2 sequence at their 3´ ends (Supplemental File, sequences.xlsx). The RNA sequence consisted of the sequence of interest flanked by a reference hairpin on each side serving as internal structural controls. The DNA template was assembled through DNA primer assembly using primers designed using the Primerize tool (https://primerize.stanford.edu/). Designed primers were ordered in plate format from Integrated DNA Technologies (IDT) and assembled via PCR assembly with Phusion DNA polymerase as described on the Primerize PCR Assembly Protocol (https://primerize.stanford.edu/protocol/#PCR). Assembly products were verified for size via agarose gel electrophoresis and subsequently purified using Agencourt RNAClean XP beads. Purified DNA was quantified via NanoDrop (Thermo Scientific) and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Enzymatically synthesized RNA was purified with Agencourt RNAClean XP beads.
4.6 μL of the RNA sample was used to generated cDNA with SuperScript II reverse transcriptase with Mn2+ as the divalent ion to promote incorporation of mismatches or deletions across bypassed methylations. Reverse transcription reactions included 0.02 μM primer in final volume 12 μL; buffer of 25 mM Tris-HCl, pH 8.3, 75 mM KCl, 6 mM MnCl2, 5 mM DTT; and incubation of at 42 °C for 3 hrs. Reverse transcription reactions were stopped with 5 μL of 0.4 M sodium hydroxide at 90 °C for 3 min. Reactions were neutralized with acid quench (2 volumes 5 M NaCl, 2 volumes 2 M HCl, and 3 volumes of 3 M Na–acetate). cDNA was purified with Agencourt Ampure beads supplemented with PEG-8000, and purified cDNA was resuspended in 12.5 μL of RNase free water. 2.5 μL of cDNA was used for PCR with Illumina adapters (see Supplemental File sequences.xlsx). We found it necessary to perform emulsion PCR. For these reactions, we prepared an oil phase system composed of ABIL EM90, (Evonika) 80 μL, Triton X-100, 1.0 μL, and mineral oil, 1919 μL. Reactions combined 300 μL of this oil phase with 50 μL PCR mixture, composed of Phusion DNA polymerase, 1x Phusion buffer, 10 mM dNTPs, and 2 μM of each forward and reverse primer. We performed PCR at 98 °C, 30 sec-1 cycle; then 22 cycles of 98 °C for 10 sec, 64 °C for 30 sec, 72 °C for 30 sec; and 72 °C for 10 min for 1 cycle. The resulting dsDNA was purified by gel extraction and purification in Qiagen Qiaquick purification spin columns. The dsDNA was quantified with a Qubit instrument with the HS dsDNA kit.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Raw sequencing files were demultiplexed using novobarcode.
For M2-seq analysis of the HIV 3' UTR construct, the demultiplexed files were run through the ShapeMapper software, and the resulting mutational profile strings were run through the M2-seq analysis pipeline (further details can be found at: https://github.com/ribokit/m2seq) to yield the final two-dimensional reactivity files.
For polyA length analysis, raw demultiplexed reads were analyzed with custom python scripts that directly searched for polyAs surrounded by constant flanking regions. For more information see: https://github.com/DasLab/Anomalous_polyA_RT.
For reactivity analysis, the demultiplexed reads were analyzed with the RNAFramework, ShapeMapper, and ShapeMapper2 pipelines. Custon python scripts were then used to compare computed reactivities between packages.
For more information see: https://github.com/DasLab/Anomalous_polyA_RT.
genome build:
GGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATGCTGCATATAAGCAGCTGCTTTTTGCCTGT
ACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAAAAAAAAAAAAAAAAAAAAAAAGAAACAACAACAACAAC
Supplementary_files_format_and_content:
For HIV 3'UTR M2-seq analysis: mutation strings indicating the location of mutations for each read are provided in the format of one read per line in a one-hot encoding.
Two-dimensional reactivity files are provided in the RDAT file format as specified here: https://rmdb.stanford.edu/deposit/specs/.
For polyA length analysis, CSV tables are provided for each construct, with each column representing data relevant to a single condition (e.g. reverse transcribed with TGIRT). Values in each cell represent the raw number of reads corresponding to a given polyA length. For insertion/substitution tables, the frequency of an insertion or substitution at each nucleotide along the polyA tail (read in 3' to 5' direction).
For reactivity analysis, each plain text file contains the reactivity of a construct for a given condition. Each line contains a reactivity score of a single nucleotide position.
|
| |
|
| Submission date |
Apr 21, 2020 |
| Last update date |
Apr 23, 2020 |
| Contact name |
Rhiju Das |
| E-mail(s) |
rhiju@stanford.edu
|
| Organization name |
Stanford University School of Medicin
|
| Department |
Biochemistry
|
| Lab |
Das
|
| Street address |
279 Campus Dr, B419 Beckman Center
|
| City |
Stanford |
| State/province |
California |
| ZIP/Postal code |
94305 |
| Country |
USA |
| |
|
| Platform ID |
GPL28440 |
| Series (1) |
| GSE149061 |
Anomalous reverse transcription through chemical modifications in polyadenosine stretches |
|
| Relations |
| BioSample |
SAMN14655869 |
| SRA |
SRX8151467 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4489497_HIV_3UTR_processed.tar.gz |
41.8 Mb |
(ftp)(http) |
TAR |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
