 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 07, 2020 |
| Title |
eIF4A1_RocA3uM_ADP |
| Sample type |
SRA |
| |
|
| Source name |
eIF4A1_RocA3uM_ADP
|
| Organism |
synthetic construct |
| Characteristics |
recombinant protein: SBP-tagged eIF4A1
binding constructs: CTCTTTCCCTACACGACGCTCTTCCGATCT*-N30-*ATCGTAGATCGGAAGAGCACACGTCTGAA
treatment: RocA 3 microM
|
| Treatment protocol |
DMSO or RocA for 30min
|
| Extracted molecule |
total RNA |
| Extraction protocol |
A hundred pmol of SBP-tagged recombinant proteins (DDX3 helicase core or eIF4A1) was incubated with 60 ul of Dynabeads M-270 Streptavidin (Thermo Fisher Scientific), which were pre-equilibrated with equilibration buffer containing 1% Triton X-100, at 4 C for 30 min. Protein-tethered beads were treated with 2 U/ ul Micrococcal Nuclease (Takara) in 0.5 equilibration buffer, and 0.5% Triton X-100 in 30 l at 25 C for 30 min. After the incubation, the beads were washed 5 times with 60 l of equilibration buffer containing 1% Triton X-100, 1 M NaCl, and 5 mM EGTA pH 7.4, and rinsed twice with the same volume of equilibration buffer containing 0.1% Triton X-100. The rinsed beads were then incubated with 50 M oligonucleotide of 5c-*CTCTTTCCCTACACGACGCTCTTCCGATCT*-N30- *ATCGTAGATCGGAAGAGCACACGTCTGAA*-3T (letters in all capitals represent DNA sequence and N represents random RNA sequence) in 30 l of equilibration buffer containing 0.1% Triton X-100, 0.33 U/ l SUPERase In RNase Inhibitor (Thermo Fisher Scientific), 2 mM ADP and 2 mM Na2HPO4 with 3 M RocA (or 1% DMSO). Following reaction at 37 C for 30 min, the beads were washed 5 times with an equilibration buffer containing 0.1% Triton X-100, 2 mM ADP and 2 mM Na2 HPO4 with 3 M RocA (or 1% DMSO). Beads-tethered protein-RNA complex was eluted using 30 ul of equilibration buffer containing 0.1% Triton X-100, 5 mM D-biotin (Invitrogen), 2 mM ADP and 2 mM Na2HPO4 with 3 M RocA (or 1% DMSO) at 4 C for 30 min. Eluted RNAs were purified using Oligo Clean & Concentrator kit (Zymo Research) and transcribed into DNA library as described in ribosome profiling. RNA Bind-n-Seq with the condition of 2 mM AMP-PNP was performed as described above for the condition of 2 mM ADP and 2 mM Na2HPO4, but incubation with 1 M oligonucleotide.
Bind-n-Seq reference: PMID 24837674
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
Bind-n-Seq
|
| Data processing |
Library strategy: Bind-n-Seq
Basecalling with Illumina Casava 1.8 software
3' adapter trimming with FastX-toolkit
Supplementary_files_format_and_content: csv files contain the following values: 1) value: the number of tetramer motifs; 2) probability: the ratio of tetramer motifs to total of sample; 3) probability input: the ratio of tetramer motifs to total of input; 4) Rvalue: probability/probability input
|
| |
|
| Submission date |
May 08, 2020 |
| Last update date |
Dec 07, 2020 |
| Contact name |
Mingming Chen |
| E-mail(s) |
mingming.chen@riken.jp
|
| Phone |
07031428686
|
| Organization name |
RIKEN
|
| Department |
CPR
|
| Lab |
RNA systems biochemistry lab
|
| Street address |
Hirisawa 2-2
|
| City |
Wakoshi |
| State/province |
Saitama |
| ZIP/Postal code |
351-0106 |
| Country |
Japan |
| |
|
| Platform ID |
GPL21616 |
| Series (1) |
| GSE150111 |
Dual targeting of DDX3 and eIF4A by the translation inhibitor rocaglamide A [Bind-n-Seq] |
|
| Relations |
| BioSample |
SAMN14854779 |
| SRA |
SRX8293375 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4523763_eIF4A1_ADP.RocA3uM.4mer.csv.gz |
5.7 Kb |
(ftp)(http) |
CSV |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
