genotype: trasngenic wild type plant (contains trigger and silencer transgenes) ecotype: Columbia
Growth protocol
Seeds were germinated on soil and grown for approximately 5 weeks at 22-23°C under a light cycle of 8 hours dark, 16 hours light. Mixed stage floral inflorescences (inflorescence meristem and floral buds to stage 12) were harvested between 9 and 12 AM and stored in 50 ml Falcom tubes at -80°C.
Extracted molecule
total RNA
Extraction protocol
Total RNA was isolated from mixed stage inflorescence tissues of the transgenic wild type and the dms4-1 mutant using TRIzol reagent (Invitrogen). Total RNA (300 ug) for each sample was used to construct the small RNA libraries as described previously (Lu et al., 2007) but with different adapters. The RNA oligos (Dharmacon) used for small RNA ligations were as follows: 5' RNA Adapter (5'OH-GUUCAGAGUUCUACAGUCCGACGAUC-OH 3’) and 3' RNA Adapter: (5'pUCGUAUGCCGUCUUCUGCUUGUidt 3’; p, phosphate; idT, inverted deoxythymidine). Libraries were sequenced on an Illumina GAII following the manufacturer's protocols at the Delaware Biotechnology Institute.
Library strategy
RNA-Seq
Library source
transcriptomic
Library selection
size fractionation
Instrument model
Illumina Genome Analyzer II
Description
quantitative data on primary and secondary siRNAs
Data processing
Adapter sequences were removed using a Perl script, generating small RNA sequences plus abundances. Alignment: The data were matched to the Arabidopsis genome as well as the transgenes described in Kanno et al. (2008). Of the 6,670,921 total reads from transgenic wild type and 5,809,235 from the dms4-1 mutant, 5,155,187 (wt) and 4,069,752 (dms4-1) reads matched the genome excluding 275,681 (wt) and 522,229 (dms4-1) that matched tRNA, rRNA, snRNA or snoRNAs Genome wide comparison: For the genome-wide comparison of the two libraries (dms4-1 versus wildtype T+S), we used a simplified analysis in which we arbitrarily defined 500 bp bins that cover the entire genome; in some cases, the repeat elements might be split into two clusters (although manual inspection showed this was relatively rare). We then filtered the set to identify those clusters which show greater than 10X difference in each comparison and for which the sum of abundance in each individual library was >10 TP2M. Loci encoding structural RNAs (tRNAs, rRNAs, snRNAs, snoRNAs) were removed from consideration.