NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4575912 Query DataSets for GSM4575912
Status Public on May 29, 2020
Title Patient10_normal
Sample type SRA
 
Source name brain
Organism Homo sapiens
Characteristics disease state: Glioblastoma
age (y): 49
Sex: F
location: parietal
tissue: normal brain
Extracted molecule total RNA
Extraction protocol RNA was extracted from both tissue groups by using Trizol and Ambion The Pure Link RNA Mini Kit according to the manufacturer's protocol
Libraries of the 12 sample pairs were built according to the Ion Ampliseq Human Gene Expression protocol. Briefly, 10ng total RNA was reverse transcribed, cDNA was amplified for 12 cycles by adding Hi-Fi master mix and Ion Ampliseq Human Gene Expression primer pool. For digestion, FuPa reagent was added and barcode adapters ligated to the amplicons. After washing with magnetic beads, libraries were eluted and measured with qRT-PCR. Libraries were concentration-equalized. Emulsion PCR was performed in the Ion One Touch System (Thermo Fisher).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Ion Torrent S5
 
Description 10N
Data processing adapter trimming with cutadapt v2.5 (-a ATCACCGACTGCCCATAGAGAGGCTGAGAC -q 17,17 --minimum-length 50 --trim-n --max-n=0.1)
filter mapping with bwa mem v0.7.14-r1136 to rRNA/tRNA FASTA
quality trimming with fqtrim v0.9.5 (-p2)
alignment to GRCh37.87 reference using STAR v2.5.2b
feature counting with subread v1.5.2 featureCounts (-t exon -g gene_id -T 16 -s 2 -a Homo_sapiens.GRCh37.87.gtf)
differential expression analysis using DESeq2
Genome_build: GRCh37.87
Supplementary_files_format_and_content: comma-separated text with rlog-normalized count data
 
Submission date May 28, 2020
Last update date May 29, 2020
Contact name Steffen Uebe
E-mail(s) steffen.uebe@uk-erlangen.de
Phone +49-9131-85-26101
Organization name Universitaetsklinikum Erlangen
Department Humangenetisches Institut
Street address Schwabachanlage 10
City Erlangen
ZIP/Postal code 91054
Country Germany
 
Platform ID GPL23934
Series (1)
GSE151352 Targeted transcriptome profiling of fresh paired normal and tumor tissue samples in glioblastoma patients
Relations
BioSample SAMN15044552
SRA SRX8413201

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap