|
Status |
Public on May 29, 2020 |
Title |
Patient25_normal |
Sample type |
SRA |
|
|
Source name |
brain
|
Organism |
Homo sapiens |
Characteristics |
disease state: Glioblastoma age (y): 38 Sex: M location: frontal tissue: normal brain
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was extracted from both tissue groups by using Trizol and Ambion The Pure Link RNA Mini Kit according to the manufacturer's protocol Libraries of the 12 sample pairs were built according to the Ion Ampliseq Human Gene Expression protocol. Briefly, 10ng total RNA was reverse transcribed, cDNA was amplified for 12 cycles by adding Hi-Fi master mix and Ion Ampliseq Human Gene Expression primer pool. For digestion, FuPa reagent was added and barcode adapters ligated to the amplicons. After washing with magnetic beads, libraries were eluted and measured with qRT-PCR. Libraries were concentration-equalized. Emulsion PCR was performed in the Ion One Touch System (Thermo Fisher).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Ion Torrent S5 |
|
|
Description |
25N
|
Data processing |
adapter trimming with cutadapt v2.5 (-a ATCACCGACTGCCCATAGAGAGGCTGAGAC -q 17,17 --minimum-length 50 --trim-n --max-n=0.1) filter mapping with bwa mem v0.7.14-r1136 to rRNA/tRNA FASTA quality trimming with fqtrim v0.9.5 (-p2) alignment to GRCh37.87 reference using STAR v2.5.2b feature counting with subread v1.5.2 featureCounts (-t exon -g gene_id -T 16 -s 2 -a Homo_sapiens.GRCh37.87.gtf) differential expression analysis using DESeq2 Genome_build: GRCh37.87 Supplementary_files_format_and_content: comma-separated text with rlog-normalized count data
|
|
|
Submission date |
May 28, 2020 |
Last update date |
May 29, 2020 |
Contact name |
Steffen Uebe |
E-mail(s) |
steffen.uebe@uk-erlangen.de
|
Phone |
+49-9131-85-26101
|
Organization name |
Universitaetsklinikum Erlangen
|
Department |
Humangenetisches Institut
|
Street address |
Schwabachanlage 10
|
City |
Erlangen |
ZIP/Postal code |
91054 |
Country |
Germany |
|
|
Platform ID |
GPL23934 |
Series (1) |
GSE151352 |
Targeted transcriptome profiling of fresh paired normal and tumor tissue samples in glioblastoma patients |
|
Relations |
BioSample |
SAMN15044546 |
SRA |
SRX8413207 |