|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 16, 2010 |
Title |
Wild-type |
Sample type |
SRA |
|
|
Source name |
wt
|
Organism |
Schizosaccharomyces pombe |
Characteristics |
strain: SPB80
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated from cells harvested at OD600=0.5 using the hot phenol method (Leeds, 1991) and subjected to size fractionation using RNeasy Midi columns (QIAGEN) as previously described (Buhler, 2006). 17-30nt small RNAs were PAGE purified and were cloned based upon the preactivated, adenylated linkering method described previously (Lau, 2001) using a mutant T4 RNA ligase (Rnl21-249) (Ho, 2004). Bar coded linkers suitable for Solexa sequencing were used for multiplexing and sequencing using an Illumina Genome Analyzer 2 (GA2).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer II |
|
|
Description |
Schizosaccharomyces pombe small RNA library from total RNA isolations, barcode 5' AAAC, 3' TCGTATGCCGTCTTCTGCTTG
|
Data processing |
All samples were barcoded at the 3'end of the 5'adapter using a hamming distance two code with a 3' cytosine (AAAC,ACCC,AGGC,ATTC,CACC,CCGC,CGTC,CTAC,GAGC,GCTC,GGAC,GTCC,TATC,TCAC,TGCC,TTGC) and sequenced (with other samples) in one lane of an Illumina GA2 instrument. Individual reads were assigned to their sample based on the first 4 nucleotides containing the barcode. The 3' adapter was removed by aligning it to the read allowing one or two mismatches in prefix alignments of at least 7 or 10 bases respectively. Low complexity reads were filtered out based on their dinucleotide entropy (removing <1% of the reads). All the reads that were shorter than 14 nucleotides were removed.
|
|
|
Submission date |
Oct 15, 2009 |
Last update date |
May 15, 2019 |
Contact name |
Dimos Gaidatzis |
E-mail(s) |
d.gaidatzis@fmi.ch
|
Organization name |
Friedrich Miescher Institute
|
Street address |
Maulbeerstrasse 66
|
City |
Basel |
ZIP/Postal code |
4058 |
Country |
Switzerland |
|
|
Platform ID |
GPL9453 |
Series (1) |
GSE18582 |
Nuclear retention of fission yeast dicer is a prerequisite for RNAi-mediated heterochromatin assembly |
|
Relations |
SRA |
SRX016552 |
BioSample |
SAMN00008670 |
Supplementary file |
Size |
Download |
File type/resource |
GSM462212_01_wt.tab.gz |
1.6 Mb |
(ftp)(http) |
TAB |
SRA Run Selector |
Processed data provided as supplementary file |
Raw data are available in SRA |
|
|
|
|
|