 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 16, 2010 |
| Title |
dcr1Delta |
| Sample type |
SRA |
| |
|
| Source name |
dcr1Delta
|
| Organism |
Schizosaccharomyces pombe |
| Characteristics |
strain: SPB81
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated from cells harvested at OD600=0.5 using the hot phenol method (Leeds, 1991) and subjected to size fractionation using RNeasy Midi columns (QIAGEN) as previously described (Buhler, 2006). 17-30nt small RNAs were PAGE purified and were cloned based upon the preactivated, adenylated linkering method described previously (Lau, 2001) using a mutant T4 RNA ligase (Rnl21-249) (Ho, 2004). Bar coded linkers suitable for Solexa sequencing were used for multiplexing and sequencing using an Illumina Genome Analyzer 2 (GA2).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
Schizosaccharomyces pombe small RNA library from total RNA isolations, barcode 5' ACCC, 3' TCGTATGCCGTCTTCTGCTTG
|
| Data processing |
All samples were barcoded at the 3'end of the 5'adapter using a hamming distance two code with a 3' cytosine (AAAC,ACCC,AGGC,ATTC,CACC,CCGC,CGTC,CTAC,GAGC,GCTC,GGAC,GTCC,TATC,TCAC,TGCC,TTGC) and sequenced (with other samples) in one lane of an Illumina GA2 instrument. Individual reads were assigned to their sample based on the first 4 nucleotides containing the barcode. The 3' adapter was removed by aligning it to the read allowing one or two mismatches in prefix alignments of at least 7 or 10 bases respectively. Low complexity reads were filtered out based on their dinucleotide entropy (removing <1% of the reads). All the reads that were shorter than 14 nucleotides were removed.
|
| |
|
| Submission date |
Oct 15, 2009 |
| Last update date |
May 15, 2019 |
| Contact name |
Dimos Gaidatzis |
| E-mail(s) |
d.gaidatzis@fmi.ch
|
| Organization name |
Friedrich Miescher Institute
|
| Street address |
Maulbeerstrasse 66
|
| City |
Basel |
| ZIP/Postal code |
4058 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL9453 |
| Series (1) |
| GSE18582 |
Nuclear retention of fission yeast dicer is a prerequisite for RNAi-mediated heterochromatin assembly |
|
| Relations |
| SRA |
SRX016553 |
| BioSample |
SAMN00008671 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM462213_02_ddcr1.tab.gz |
797.4 Kb |
(ftp)(http) |
TAB |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
