|
| Status |
Public on Oct 27, 2020 |
| Title |
Long read Nab2-AA rep1 |
| Sample type |
SRA |
| |
|
| Source name |
MATα tor1-1 fpr1Δ::loxP-LEU2-LoxP RPL13A-2xFKBP12::LoxP-TRP1-LoxP NAB2-FRB::HIS
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
genotype: MATalpha tor1-1 fpr1{delta}::loxP-LEU2-LoxP RPL13A-2xFKBP12::LoxP-TRP1-LoxP NAB2-FRB::HIS
treatment: rapamycin (1 ug/ml) for 10 min
molecule subtype: nascent RNA
|
| Treatment protocol |
Rapamycin was added to exponentially growing cells to a final concentration of 1 ug/ml for either 10 or 30 minutes.
|
| Growth protocol |
Yeast cells were grown in YPAD medium at 30°C into log phase (OD600 = 0.5-0.8). For Nab2-AA and Control-AA strains, rapamycin was added at a final concentration of 1 ug/ml for either 10 or 30 minutes. Cells were pelleted at 4°C and washed with cold 1x PBS before snap freezing.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nascent RNA was extracted as previously described (Carrillo et al 2010). Briefly, chromatin isolated from frozen cell pellets is incubated with phenol-chloroform to extract nucleotides. DNA is digested with DNase and polyA sequences are depleted using oligo(dT) beads. For long read sequencing, ribosomal RNA was depleted using a cap-dependent exonuclease.
SMIT library construction was performed as described previously (Carrillo et al. 2016). Briefly, a 3′ end adapter (/5rApp/NNNNNCTGTAGGCACCATCAAT/3ddC/) was ligated to nascent RNA and samples were reverse transcribed. Gene-specific forward primers were used to amplify the cDNA and a second PCR added Illumina library adapters. Long read sequencing utilized the same adapter ligation strategy used in SMIT. Strand-switching reverse transcription created full length double-stranded cDNA molecules with common 5′ and 3′ ends. An initial PCR of 12-15 cycles amplified product for input into the ONT PCR Barcoding kit (SQK-PBK004) which includes dA-tailing and barcode adapter ligation. A final PCR of 8-10 cycles enriched for successful ligation and AMPure XP bead purification removes products under 250 bp. The final library was loaded onto an Oxford Nanopore MinION flow cell and sequenced for 48 hours.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
MinION |
| |
|
| Description |
Nab2AA
processed data file: longread_fractionspliced.txt
|
| Data processing |
library strategy: SMIT and long read sequencing of nascent RNA
For SMIT, data processing was completed as previously published (Carrillo et al. 2016) with the exception that reads were mapped with Hisat2 (v2.1.0). First, fastq files are filtered for quality with the Fastx Toolkit (v 0.0.14) fastq_quality_filter function (-Q 33 -q 20 -p 90). 3′ end adapter and Illumina adapter sequences were trimmed using Cutadapt (v1.9.1). For R1: -g CATTGATGGTGCCTACAG -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -n 2 -O 18 -m 23 -e 0.11 --match-read-wildcards --discard-untrimmed. For R2: -a CTGTAGGCACCATCAATG -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -n 2 -m 28 -M 76 -e 0.11 --match-read-wildcards. Prinseq-lite (v0.20.4) removed PCR duplicates (-out_format 3 -qual_noscale -ns_max_p 1 -derep 1). The resulting reads had a remaining 5 N bases from the SMIT primer which aid in deduplication. These bases were trimmed with the FastX Toolkit fastx_trimmer tool (for R1: -Q 33 -f 6; for R2: -Q 33 -t 5). Reads were then mapped to the SacCer3 genome annotation using Hisat2 (v2.1.0) (--phred33 --no-mixed --min-intronlen 30 --max-intronlen 1010 -p 5). PolyA sequences were removed from the SAM file with a custom script. Custom R scripts compiled the number of spliced and unspliced reads for every position in the second exon of intron-containing genes. Fraction spliced values were normalized to correct for an insert length bias introduced by the PCR (https://github.com/carrillo/SMITproject/blob/master/smit_r/insert_length_model.R). Fraction spliced values were modeled with ggplot2 (v 3.2.1) geom_smooth function using the loess method (span = 0.15). The distance matrix between the fraction spliced of Control and Sample (considering only the first 300 nt after the 3′ SS) was generated for each gene using the R stats dist function (v3.6.1) using the Euclidean method. The matrix was collapsed into a single value by finding the median which is assigned as the ΔSMIT value for that gene.
For long read sequencing, the raw fast5 files were basecalled with Guppy (v3.3.0) with default quality filter parameters and basecalled reads were demultiplexed with Qcat (v1.1.0). Nanopore adapters were trimmed with Cutadapt (v1.9.1) and 3′ end adapter sequence was removed with the following parameters (cutadapt -a CTGTAGGCACCATCAATG -e 0.17 -O 6 -m 5 --match-read-wildcards --discard-untrimmed). Reads which had 3′ end adapter on 5′ end (cutadapt -g AAGCAGTGGTATCAACGCAGAGTAC -e 0.17 -O 6 -m 5 --match-read-wildcards) were reverse complemented using a custom script. Trimmed reads were then mapped to the sacCer3 genome with minimap2 (v2.17) (-ax splice -k 10 -G 2000 –secondary=no). Reads with polyA tails were removed using a custom script. Reads with 30 or more soft-clipped bases which contain a stretch of 10 A’s were removed. Reads with less than 30 soft-clipped bases which contain 6 A’s were removed. Bam and bed files were generated using Samtools (v1.9) and BEDTools (v 2.29.2) respectively. Custom R scripts were written identify intrusive and readthrough reads using transcript start and end positions defined by Nagalakshmi et al 2008. Fraction spliced of reads with 3′ ends downstream of the 3′ SS was determined using the DescTools (v0.99.30) Overlap function.
Genome_build: sacCer3
Supplementary_files_format_and_content: tab-delimited text files with fraction spliced for each gene
Supplementary_files_format_and_content: tab-delimited text files with the deltaSMIT value for each gene
Supplementary_files_format_and_content: .bed file for mapped long read data filtered for reads overlapping intron-containing genes only; BED12 file with extra column to identify gene.
Supplementary_files_format_and_content: longread_fractionspliced.txt
|
| |
|
| Submission date |
Aug 12, 2020 |
| Last update date |
Oct 28, 2020 |
| Contact name |
Tara Diane Alpert |
| E-mail(s) |
tara.alpert@yale.edu
|
| Organization name |
Yale University
|
| Department |
Molecular Biophysics and Biochemistry
|
| Lab |
Karla Neugebauer
|
| Street address |
333 Cedar St.
|
| City |
New Haven |
| State/province |
CT |
| ZIP/Postal code |
06511 |
| Country |
USA |
| |
|
| Platform ID |
GPL25739 |
| Series (1) |
| GSE156133 |
Widespread transcriptional readthrough caused by Nab2 depletion leads to chimeric transcripts with retained introns |
|
| Relations |
| BioSample |
SAMN15804167 |
| SRA |
SRX8934925 |
