NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4758206 Query DataSets for GSM4758206
Status Public on Sep 04, 2020
Title KRG090619_aegypti_Ago2_Exp5A
Sample type SRA
 
Source name whole organism
Organism Aedes aegypti
Characteristics strain: Orlando
treatment: UV 254 nm
clip antibody: Ago2
cloning strategy: BrdU (UMI is already appended to read name in order to de-multiplex; no other processing)
Extracted molecule total RNA
Extraction protocol CLIP libraries were prepared using custom Ago1, Drosophila Ago2 (9D6; a kind gift from M. Siomi), or paired irrelevant IgG control antibodies, from Aag2 cells or whole homogenized female Aedes aegypti mosquitoes.
 
Library strategy RIP-Seq
Library source transcriptomic
Library selection other
Instrument model Illumina MiSeq
 
Description Ago-CLIP RNA
Data processing All raw files provided are not quality filtered and uncollapsed, provided as fastq files. Standard samples are split by index but are not processed further; they still contain the 5'index/linker/UMI (27nt total) and the 3'linker (GTGTCAGTCACTTCCAGCGG). BrdU samples have the 7nt UMI stripped and appended to the read name in order to de-multiplex, but otherwise contain the 5' index + 3 Ds (9nt) and the 3' linker (GTGTCAGTCACTTCCAGCGG).
Sequenced reads were collapsed to remove exact duplicates, adaptors, indices, and UMIs were removed, and reads were mapped to the Aedes aegypti AaegL5 genome assembly using Rbowtie2 v1.4.0 (--threads 4 -f -N 1 -L 18).
Peaks were called in all samples using HOMER v4.8.1 makeTagDirectory (-single -format bed) and findPeaks ( -o auto -style factor -L 2 -localSize 10000 -strand separate -minDist 50 -size 10 -fragLength 25 -gsize 1278731969).
Overlapping peak genomic ranges were reduced to yield unique ranges and reads at each peak were counted in the peak matrix by sample.
Genome_build: AaegL5
Supplementary_files_format_and_content: all_samples_raw_count_peak_matrix.txt
 
Submission date Aug 31, 2020
Last update date Sep 04, 2020
Contact name Kathryn Rozen-Gagnon
E-mail(s) krozen@rockefeller.edu
Phone 2123277054
Organization name The Rockefeller University
Street address 1230 York Avenue, Box 64
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL22761
Series (1)
GSE157168 Argonaute-CLIP delineates versatile, functional RNAi networks in Aedes aegypti, a major vector of human viruses
Relations
BioSample SAMN15947031
SRA SRX9040295

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap