|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Sep 04, 2020 |
Title |
KRG121817B_Aag2_Ago1_Exp2A |
Sample type |
SRA |
|
|
Source name |
cell line
|
Organism |
Aedes aegypti |
Characteristics |
cell line: Aag2 treatment: UV 254 nm clip antibody: Ago1 cloning strategy: standard linker ligation (not processed, de-multiplexed)
|
Extracted molecule |
total RNA |
Extraction protocol |
CLIP libraries were prepared using custom Ago1, Drosophila Ago2 (9D6; a kind gift from M. Siomi), or paired irrelevant IgG control antibodies, from Aag2 cells or whole homogenized female Aedes aegypti mosquitoes.
|
|
|
Library strategy |
RIP-Seq |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
Ago-CLIP RNA
|
Data processing |
All raw files provided are not quality filtered and uncollapsed, provided as fastq files. Standard samples are split by index but are not processed further; they still contain the 5'index/linker/UMI (27nt total) and the 3'linker (GTGTCAGTCACTTCCAGCGG). BrdU samples have the 7nt UMI stripped and appended to the read name in order to de-multiplex, but otherwise contain the 5' index + 3 Ds (9nt) and the 3' linker (GTGTCAGTCACTTCCAGCGG). Sequenced reads were collapsed to remove exact duplicates, adaptors, indices, and UMIs were removed, and reads were mapped to the Aedes aegypti AaegL5 genome assembly using Rbowtie2 v1.4.0 (--threads 4 -f -N 1 -L 18). Peaks were called in all samples using HOMER v4.8.1 makeTagDirectory (-single -format bed) and findPeaks ( -o auto -style factor -L 2 -localSize 10000 -strand separate -minDist 50 -size 10 -fragLength 25 -gsize 1278731969). Overlapping peak genomic ranges were reduced to yield unique ranges and reads at each peak were counted in the peak matrix by sample. Genome_build: AaegL5 Supplementary_files_format_and_content: all_samples_raw_count_peak_matrix.txt
|
|
|
Submission date |
Aug 31, 2020 |
Last update date |
Sep 04, 2020 |
Contact name |
Kathryn Rozen-Gagnon |
E-mail(s) |
krozen@rockefeller.edu
|
Phone |
2123277054
|
Organization name |
The Rockefeller University
|
Street address |
1230 York Avenue, Box 64
|
City |
New York |
State/province |
NY |
ZIP/Postal code |
10065 |
Country |
USA |
|
|
Platform ID |
GPL21020 |
Series (1) |
GSE157168 |
Argonaute-CLIP delineates versatile, functional RNAi networks in Aedes aegypti, a major vector of human viruses |
|
Relations |
BioSample |
SAMN15947092 |
SRA |
SRX9040352 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|