|
| Status |
Public on Jun 30, 2021 |
| Title |
v_24_s_bc |
| Sample type |
SRA |
| |
|
| Source name |
SupT1 culture supernatant (containing NL4-3-ΔEnv-GFP/VSV-G)
|
| Organism |
Human immunodeficiency virus |
| Characteristics |
cell type: CD4+ T cells (SupT1)
viral strain: NL4-3-ΔEnv-GFP/VSV-G
time point: 24h
|
| Treatment protocol |
SupT1 cells (5×106 cells) were either mock-treated or infected with 5 µg p24 equivalent of HIV-GFP by spinoculation at 1500 g for 30 min at 20°C, in presence of 4 µg/ml polybrene (Sigma), in 400 µl final volume in 14 ml round bottom polypropylene tubes - a total of 50 tubes were used for mock condition and 50 tubes for infected condition to obtain a total of 250 million cells for each condition. At 12, 24 and 36h post-infection virus-containing supernatant was collected and either directly frozen at -80° for RNA extraction or previously concentrated by filtration on Centricon units (Centricon Plus-70/100K, Millipore).
|
| Growth protocol |
SupT1 cells are human T cell lymphoblasts. They were cultured in R10 (RPMI 1640 with 1x glutamax (#61870-010, Invitrogen) containing 10% heat-inactivated FBS and 50 µg/ml Gentamicin) and split twice a week at 0.5x106 cells/ml to maintain a maximal concentration of 1x106 cells/ml.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from concentrated or non-concentrated viral particles using Trizol Reagent (#15596026 Invitrogen) according to suppliers’s instructions. Briefly, samples were thawed at room temperature and 200µl chloroform were added to the mixture. Samples were centrifuged for 30min at 10000g, at 4°C and the RNA–containing, aqueous (upper) phase was transferred to a fresh tube and subjected to precipitation with 0,5 ml of isopropanol for 1h at -80°C. Samples where then centrifuged for 10 min at 12000g, washed once in 1ml of 75% ethanol and resuspended in 50 μl H2O. PolyA viral RNA was then subjected to fragmentation using Ambion RNA Fragmentation Reagents (#AM8740, Life Technologies), in order to obtain fragments of 100-200nt. Samples were then subjected to bisulfite conversion using the EZ RNA methylation Kit (#R5001, Zymo Research).
Libraries for sequencing were prepared using Illumina TruSeq Stranded mRNA kits (#20020594, Illumina), starting the protocol at the Elute-Prime-Fragment step, and with a protocol modification consisting in incubating the samples at 80 °C for 2 minutes to only prime but not further fragment the samples
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
transcriptomic |
| Library selection |
RANDOM |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Bisulfite converted RNA derived from HIV viral particles extracted from non-concentrated cellular supernatant collected 24h post-infection
Bisulfite converted sample
Viral RNA
|
| Data processing |
Cutadapters: cutadapt --minimum-length 25 -a AGATCGGAAGAGCACACGTCTGAAC
Reverse complement reads: seqkit seq -r -p
Align using meRanGh: meRanGh align -o ${outdir} -f 12_LV_bc__L6_R1_001_z4n6O3Spnge2_trim_rev.fastq -t 24 -S ${outdir}/12_LV.sam -ud ${outdir}/un -un -MM -id /data/hg38_hiv/BSgenomeIDX -GTF /mnt/biodata/genomes/Hsapiens/hg38/rnaseq/ref-transcripts.gtf -bg -mbgc 10
Extract and assign multimapped LTR regions from multimap alignment file to beginning of HIV strand: sambamba merge ${f1/sorted/hivltr} $f1 <(samtools view -b ${f1/sorted/multimappers_sorted} integrated:8500-100000)
Call methylated bases: meRanCall -p 12 -o ${output} -bam ${input} -f /data/hg38_hiv/hg38_hiv.fa -rl 126 -sc 10 -ei 0.1 -cr 0.99 -bed63 -np -gref
Genome_build: merged: hg38, NC_001802
Supplementary_files_format_and_content: Text, methylated base calls with annotations
|
| |
|
| Submission date |
Aug 31, 2020 |
| Last update date |
Jun 30, 2021 |
| Contact name |
Paolo Angelino |
| E-mail(s) |
paolo.angelino@unil.ch, paolo.angelino@sib.swiss
|
| Organization name |
SIB Swiss Institute of Bioinformatics
|
| Department |
BCF
|
| Street address |
Quartier Sorge, Bâtiment Génopode
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL26648 |
| Series (2) |
| GSE157189 |
Characterization of the epitranscriptomic landscape of HIV-infected cells II |
| GSE157193 |
Characterization of the epitranscriptomic landscape of HIV-infected cells |
|
| Relations |
| BioSample |
SAMN15948933 |
| SRA |
SRX9042426 |
