|
| Status |
Public on Nov 12, 2020 |
| Title |
smallRNAseq_MEFs_sgZswim8-2 |
| Sample type |
SRA |
| |
|
| Source name |
MEFs
|
| Organism |
Mus musculus |
| Characteristics |
genotype: sgZswim8
sgrna received: AGTGCGGATGAGTTTCAGCG
cell line: MEFs
|
| Growth protocol |
K562 cells were grown in RPMI supplemented with 10% FBS and Antibiotic-Antimycotic solution, HEK293T and MEFs cells were grown in DMEM supplemented with 10% FBS and Antibiotic-Antimycotic solution
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was isolated using the miRNeasy Mini kit (Qiagen) for small RNA seq.
Total RNA was isolated from biological triplicates of each cell line using the miRNeasy Mini RNA isolation kit (Qiagen) including a DNase I digestion step to remove genomic DNA. Library preparation was performed following a previously published protocol (H. Kim et al., Bias-minimized quantification of microRNA reveals widespread alternative processing and 3' end modification. Nucleic Acids Res 47, 2630-2640 (2019)).
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
The raw reads were trimmed using Cutadapt
Reads with base quality less than 30 at any position were dropped
The miRNA sequences were downloaded from miRBase v22
Each read was assigned to an miRNA according to the first 18nt.
TMM normalization and differential expression analysis is performed using edgeR
Genome_build: hg19
Supplementary_files_format_and_content: a table of miRNA reads per million from edgeR analysis of these RNA-seq data
|
| |
|
| Submission date |
Sep 16, 2020 |
| Last update date |
Nov 12, 2020 |
| Contact name |
Joshua Mendell |
| E-mail(s) |
joshua.mendell@utsouthwestern.edu
|
| Organization name |
UT Southwestern Medical Center
|
| Department |
Molecular Biology
|
| Street address |
6000 Harry Hines Blvd., NA6.200A
|
| City |
Dallas |
| State/province |
TX |
| ZIP/Postal code |
75390-9148 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE151517 |
A ubiquitin ligase mediates target-directed microRNA decay independently of tailing and trimming |
| GSE158025 |
A ubiquitin ligase mediates target-directed microRNA decay independently of tailing and trimming [small RNA-seq] |
|
| Relations |
| BioSample |
SAMN16178759 |
| SRA |
SRX9131981 |
