|
| Status |
Public on Nov 25, 2020 |
| Title |
Rbs1HTP_wt_1 |
| Sample type |
SRA |
| |
|
| Source name |
Rbs1-HTP
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: BY4741
expressing: Rbs1-6xHis-TEV-2xProtA
|
| Treatment protocol |
Protein-RNA complexes were stabilized by in-vivo UV crosslinking
|
| Growth protocol |
S.cerevisiae strains expressing C-terminal HTP tagged proteins were grown at 30°C to A600 ∼ 0.5 in synthetic medium with glucose minus tryptophan.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
UV stabilized protein-RNA interactions were purified under denaturing conditions and RNAs associated with HTP tagged protein were partially truncated.
Sequencing 3' adapter and 5' adapter were ligated while protein-RNA complexes were bound to Ni-NTA agarose, RNA library was reverse transcribed and PCR amplified.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
NNNGTGAGC_Rbs1HTP_wt_1
RNA covalently attached to Rbs1
|
| Data processing |
Demultiplexing: Reads were assigned to experimental samples using their 5' barcode sequences, and barcodes were kept. Barcode is always first segment of each name: NNNAGAGC_BY4741_1.fastq NNNCACTAGC_Rbs1HTP_wt_2.fastq NNNGTGAGC_Rbs1HTP_wt_1.fastq
Collapsing reads: To remove PCR duplicates, reads were collapsed usinf fastx_collapser, part of FASTX Toolkit 0.0.14
Debarcoding: The 5' barcodes were removed using pyBarcodeFilter.py v3.0 script from pyCRAC package.
Filtering reads: Reads were trimmed using flexbar v3.4.0 to remove the 3 -linker sequence (TGGAATTCTCGGGTGCCAAGGC) and were additionaly filtered and only 3'linker-containing reads were included to further analyses. Reads alignment: Reads were aligned to the Saccharomyces cerevisiae genome sequence (Ensembl release EF4.74) by novoalign version 2.07.00.
Reads alignment: Reads were aligned to the Saccharomyces cerevisiae genome sequence (Ensembl release EF4.74) by novoalign version 2.07.00.
Additional processing: novoalign SAM reads were modified using custom made script to keep only the 5' or 3' ends of reads. SAM files were converted to BAM format using samtools v1.9 and BigWig files were generated using bamCoverage v3.1.3.
Genome_build: sacCer3, EF4.74
Supplementary_files_format_and_content: Genomic coordinates of the 3' ends of mapped reads in BigWig format
|
| |
|
| Submission date |
Oct 01, 2020 |
| Last update date |
Nov 26, 2020 |
| Contact name |
Tomasz Wojciech Turowski |
| E-mail(s) |
twturowski@gmail.com
|
| Organization name |
Insitute of Biochemistry and Biophysics PAS
|
| Department |
Laboratory of Transcription Mechanisms
|
| Lab |
Turowski Lab
|
| Street address |
Pawinskiego 5a
|
| City |
Warsaw |
| ZIP/Postal code |
02-106 |
| Country |
Poland |
| |
|
| Platform ID |
GPL26302 |
| Series (1) |
| GSE158858 |
The expression of Rpb10, a small subunit common to RNA polymerases, is modulated by the R3H domain-containing Rbs1 protein and the Upf1 helicase |
|
| Relations |
| BioSample |
SAMN16327366 |
| SRA |
SRX9227728 |
