 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 22, 2021 |
| Title |
2_2018_P_T1 |
| Sample type |
SRA |
| |
|
| Source name |
yeast liquid culture
|
| Organism |
Cryptococcus neoformans |
| Characteristics |
strain: var. grubii H99
genotype: wild_type
media: ypd_media
rna sample number: 2
enrichment method: Unenriched
library prep person: J
|
| Treatment protocol |
Approximately 1 × 109 cells from each sample were pelleted, resuspended in fresh YPD medium or tissue culture media, and incubated at 30°C for 90 min with 150 rpm shaking.
|
| Growth protocol |
Samples were prepared by growing each biological replicate of the WT and mar1d strain to mid-logarithmic growth phase in separate flasks of liquid YPD medium, with 150 rpm shaking.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were then pelleted, flash frozen on dry ice, and lyophilized for ~18 hours. Total RNA was isolated using the Qiagen RNeasy Plant Mini Kit (Qiagen, Valencia, CA); on-column DNase digestion was performed to eliminate contaminating genomic DNA. Total RNA quantity and quality were assessed using the Agilent 2100 Bioanalyzer. Purified RNA was subsequently stored at -80°C.
Purified total RNA was processed unenriched or was rRNA was depleted using either Ribo-Zero Yeast kit (Illumina), the NEBNext poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Ipswich, MA), or the RNase H method with custom oligos. Ribo-Zero and RNase H treated RNA were then cleaned up with the RNA Clean & Concentrator-5 (Zymo Research) before library preparation. RNA-Seq libraries were prepared from these enriched samples and from unenriched control samples (i.e. “Unenriched”) using the NEBNext® Ultra™ II Directional RNA Library Prep with Sample Purification Beads (NEB #E7765) (New England Biolabs, Ipswich, MA).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
General read quality was evaluated using FastQC v0.11.5 and multiqc, version 1.9
Genome and GTF files were downloaded from Ensembl Fungi (release 39) and indexed using STAR_2.5.4b
FASTQs were filtered and trimmed using fastq-mcf v1.04.807 using paramteres “-q 20 -x 0.5” and the following adapter sequences, which were supplied by NEB, and their reverse complements: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Filtered and trimmed reads were mapped and counted using STAR_2.5.4b with these parameters: –runMode alignReads –outSAMtype None –quantMode GeneCounts –genomeLoad NoSharedMemory –twopassMode None –outFilterScoreMinOverLread 0 –outFilterMatchNminOverLread 0 –outFilterMatchNmin 0 –outFilterMismatchNmax 2
An Rmarkdown notebook containing the counting pipeline is available at https://github.com/granek-pubs/rna_enrichment/tree/master/geo_submission
Genome_build: GCA_000149245.3
Supplementary_files_format_and_content: Tab-delimited text files containing raw read counts per gene in STAR format. The appropriate counts are in column 4 (counts for the 2nd read strand aligned with RNA), because the directional reads were generated using the dUTP method
|
| |
|
| Submission date |
Oct 29, 2020 |
| Last update date |
Feb 24, 2021 |
| Contact name |
Joshua Aaron Granek |
| E-mail(s) |
joshua.granek@duke.edu
|
| Organization name |
Duke University School of Medicine
|
| Department |
Department of Biostatistics and Bioinformatics
|
| Street address |
Box 3568, 213 Research Drive
|
| City |
Durham |
| State/province |
NC |
| ZIP/Postal code |
27710 |
| Country |
USA |
| |
|
| Platform ID |
GPL27451 |
| Series (1) |
| GSE160397 |
Mar1 deletion and RNA enrichment in Cryptococcus neoformans: pilot data for a high-throughput sequencing course |
|
| Relations |
| BioSample |
SAMN16591784 |
| SRA |
SRX9397531 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4872747_2_2018_P_T1_S31_L001_ReadsPerGene.out.tab.gz |
36.3 Kb |
(ftp)(http) |
TAB |
| GSM4872747_2_2018_P_T1_S31_L002_ReadsPerGene.out.tab.gz |
36.3 Kb |
(ftp)(http) |
TAB |
| GSM4872747_2_2018_P_T1_S31_L003_ReadsPerGene.out.tab.gz |
36.3 Kb |
(ftp)(http) |
TAB |
| GSM4872747_2_2018_P_T1_S31_L004_ReadsPerGene.out.tab.gz |
36.2 Kb |
(ftp)(http) |
TAB |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
