 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 02, 2022 |
| Title |
6_pos_lib_ATCACG |
| Sample type |
SRA |
| |
|
| Source name |
TFAP2AE1 GFP+ Sorted
|
| Organism |
Gallus gallus |
| Characteristics |
hh stage (time): 6
condition: Neural Crest (NC)
group: NC_6
cell type: TFAP2AE1 GFP+ Sorted
|
| Treatment protocol |
whole-embryo electroporation of ptk-TFAP2AE1-GFP.
|
| Growth protocol |
37C ex-ovo incubation
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Cranial portions of chicken heads were dissected and dissociated using Accumax. For each sample, around 20 heads were pooled for FACS sorting. GFP+ neural crest and GFP- embryonic head cells were captured by directly sorting into RNA Aqueous micro kit.
Stranded RNA-Seq was performed with NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB #E7765) according to manufactuors' instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
9846_10946_79248_HGM37BGX7_6_pos_lib_ATCACG_R1
|
| Data processing |
Demultiplexing, bcl2fastq
Trimming, CutAdapt v2.10, -j 0 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --minimum-length=25
Alignment, Hisat2 v2.1.0, -p 16 --phred33 --rna-strandness R --dta --no-unal -x ~/genome/HiSat2_ENSEMBL_galGal6/ENSEMBL_galGal6
Sort and Index, samtools v1.9, samtools sort samtools index
Quantification, featureCounts v1.6.2, ./BAM/*.BAM -T 16 -t exon -s 2 -g gene_id -a ~/genome/Gallus_gallus.GRCg6a.99.gtf -o ./counts/featureCounts.txt
Genome_build: Ensembl galGal6 (GRCg6a)
Supplementary_files_format_and_content: featureCounts.txt, (Tab delim) all samples gene-level quantification
featureCountsFiltered.txt, (Tab delim) Filtered samples gene-level quantification, also better formated for easy understanding
|
| |
|
| Submission date |
Dec 23, 2020 |
| Last update date |
Sep 02, 2022 |
| Contact name |
Marcos Simoes-Costa |
| E-mail(s) |
simoescosta@cornell.edu
|
| Organization name |
Cornell University
|
| Department |
Molecular Biology and Genetics
|
| Lab |
Simoes-Costa Lab
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
New York |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL27748 |
| Series (2) |
| GSE163768 |
OCT4-SOX2 dimers reshape the epigenome to promote neural crest multipotency [RNA-Seq] |
| GSE163961 |
OCT4-SOX2 dimers reshape the epigenome to promote neural crest multipotency |
|
| Relations |
| BioSample |
SAMN17146293 |
| SRA |
SRX9722385 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
