 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 02, 2022 |
| Title |
iNCC_Sox2_D3_1_hg38 |
| Sample type |
SRA |
| |
|
| Source name |
iNCC induction Day 3
|
| Organism |
Homo sapiens |
| Characteristics |
time: D3
condition: D3 CHIR induced iNCC
group: 1
cell type: iNCC induction Day 3
antibody: Sox2, R&D Systems (AF 2018) 1:50
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Group #1 - Cultures were dissociated using Accutase and counted to normalize cell input. Group #2, cranial neural fold dissections in HH9 stage chicken embryos.
Libraries were cell input normalized and contructed as in Rothstein & Simoes-Costa, Genome Research 2020
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
Library strategy: CUT&RUN
Demultiplexing, bcl2fastq
Trimming, CutAapt v2.1.0, -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --minimum-length=25 -j 0
Alignment, bowtie2, Group #1 --local --very-sensitive-local --no-unal --no-mixed --no-discordant --x ~/genome/bowtie2-hg38/hg38 -I 10 -X 1000 Group #2 --x ~/genome/bowtie2-GRCg6a/GRCg6a
Marking Duplicates, Picard MarkDuplicates
Filtering, samtools view, sort, index
Peak calling, MACS2 Group#1 callpeak -f BAMPE -g 2913022398 -q 0.05 --call-summits, Group #2 -g 1218492533
Genome_build: Group #1, UCSC hg38
Genome_build: Group #2, ENSEMBL galGal6 (GRCg6a)
Supplementary_files_format_and_content: .narrowPeak, MACS2 peaks
Supplementary_files_format_and_content: .bed, peak file
Supplementary_files_format_and_content: .bam, alignment files
|
| |
|
| Submission date |
Dec 28, 2020 |
| Last update date |
Sep 02, 2022 |
| Contact name |
Marcos Simoes-Costa |
| E-mail(s) |
simoescosta@cornell.edu
|
| Organization name |
Cornell University
|
| Department |
Molecular Biology and Genetics
|
| Lab |
Simoes-Costa Lab
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
New York |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL21697 |
| Series (2) |
| GSE163960 |
OCT4-SOX2 dimers reshape the epigenome to promote neural crest multipotency [CUT&RUN] |
| GSE163961 |
OCT4-SOX2 dimers reshape the epigenome to promote neural crest multipotency |
|
| Relations |
| BioSample |
SAMN17173551 |
| SRA |
SRX9746997 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4991298_iNCC_Sox2_D3_1_hg38_peaks.narrowPeak.gz |
148.0 Kb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
