|
Status |
Public on Jul 13, 2021 |
Title |
s_testis_Mov10l_KO_21dpp_F43-M5_r1.reseq [small RNA-seq] |
Sample type |
SRA |
|
|
Source name |
whole testis_Mov10l1 KO
|
Organism |
Mesocricetus auratus |
Characteristics |
genotype: Mov10l1 KO tissue: whole testis molecule subtype: small RNA
|
Treatment protocol |
Production of knock-out hamsters was carried out using an in vivo electroporation CRISPR/Cas9 system. Pairs of sgRNAs were designed to cleave Mov10l1 genomic sequence in intron 19 (sequence of DNA targets: 5´- gggtatcacatgacttgggg – 3´; 5´- ggtgttgggatcatagtgggg – 3´) and intron 20 (sequence of DNA targets: 5´-tctccactcttccatgtgggg - 3´; 5´- taccattacatttgtcagggg - 3´) in order to delete exon 20. Five animals were born of which one did not exhibit any deletion, two appeared homozygous for the deletion and were not used for breeding, and one male and one female showed modification of one allele. The male was fertile but did not transmit the allele (# of progeny = 13; 8 males + 5 females) while the female (#4) transmitted the allele into progeny (# of progeny = 10; 3 males + 4 females carried the mutant allele) when bred to a wild type animal. Subsequent breeding of heterozygotes for two generations with wild type outbred animals was performed in order to minimize possible off-targeting and inbreeding effects when heterozygotes were mated to produce homozygotes.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted from adult, 21dpp, 13dpp and 9dpp hamster testes using Sigma-Aldrich miR Premier micro RNA isolation kit according to the manufacturer´s protocol. Ribosomal RNA (rRNA) was depleted from RNA used for transcriptome analysis using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Epicentre) according to the manufacturer´s protocol. rRNA depletion was confirmed by 2100 Bioanalyzer (Agilent Technologies). For small RNA-seq analysis of testes, total RNA isolated from testes as described above was used for NextFlex Small RNA-seq v3 kit (Amplicon). Libraries were prepared according to the manufacturer´s protocol with 3´ adapter ligation overnight at 16 °C, 15 cycles used for PCR amplification and NextFlex beads used for size selection. RNA-seq libraries were sequenced by 75 nt single-end reading using the Illumina NextSeq500/550 or 100 nt single-end reading using NovaSeq6000 platform.
|
|
|
Library strategy |
ncRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
Small RNA-seq reads were trimmed in two rounds using bbduk.sh version 38.87 (https://jgi.doe.gov/data-and-tools/bbtools/). First, NEXTflex adapter were trimmed from right end: bbduk.sh -Xmx20G threads=6 in=$ {FILE}.fastq.gz out=$ {FILE}.atrim.fastq.gz literal= TGGAATTCTCGGGTGCCAAGG stats=$ {FILE}.atrim.stats overwrite=t ktrim=r k=21 rcomp=f mink=10 hdist=1 minoverlap=8 Next, 4 random bases from both sides of reads were trimmed: bbduk.sh -Xmx20G threads=6 in=$ {FILE}.atrim.fastq.gz out=$ {FILE}.trimmed.fastq.gz stats=$ {FILE}.ftrim.stats overwrite=t forcetrimright2=4 forcetrimleft=4 minlength=18 Trimmed reads were mapped to the genomes with following parameters: STAR --readFilesIn $ {FILE}.fastq.gz --genomeDir $ {GENOME_INDEX} --runThreadN 12 --genomeLoad LoadAndRemove --limitBAMsortRAM 20000000000 --readFilesCommand unpigz –c --outFileNamePrefix $ {FILENAME} --outSAMtype BAM SortedByCoordinate --outReadsUnmapped Fastx --outFilterMismatchNmax 1 --outFilterMismatchNoverLmax 1 --outFilterMismatchNoverReadLmax 1 --outFilterMatchNmin 16 --outFilterMatchNminOverLread 0 --outFilterScoreMinOverLread 0 --outFilterMultimapNmax 5000 --winAnchorMultimapNmax 5000 --seedSearchStartLmax 30 --alignTranscriptsPerReadNmax 30000 --alignWindowsPerReadNmax 30000 --alignTranscriptsPerWindowNmax 300 --seedPerReadNmax 3000 --seedPerWindowNmax 300 --seedNoneLociPerWindow 1000 --outFilterMultimapScoreRange 0 --alignIntronMax 1 --alignSJDBoverhangMin 999999999999 Genome browser coverage tracks in bigWig format were produced using bedtools v2.26.0 and wigToBigWig v 4 from UCSC: genomeCoverageBed -ibam ${FILE}.bam -bg -split -g chrNameLength.txt > ${FILE}.bedGraph wigToBigWig ${FILE}.bedGraph chrNameLength.txt ${FILE}.bw Genome_build: MesAur1.0 Supplementary_files_format_and_content: coverage genome browser tracks files: bigWig format generated in a non-stranded mode, not normalized for library size
|
|
|
Submission date |
Jan 12, 2021 |
Last update date |
Jul 14, 2021 |
Contact name |
Filip Horvat |
E-mail(s) |
filip.horvat@img.cas.cz
|
Organization name |
Institute of Molecular Genetics of the ASCR
|
Lab |
Laboratory of Epigenetic Regulations
|
Street address |
Videnska 1083
|
City |
Prague |
ZIP/Postal code |
14220 |
Country |
Czech Republic |
|
|
Platform ID |
GPL24490 |
Series (2) |
GSE164654 |
Golden hamster piRNAs are essential for early development and establishment of spermatogonia [hamster_testis.small_RNAseq] |
GSE164658 |
Golden hamster piRNAs are essential for early development and establishment of spermatogonia. |
|
Relations |
BioSample |
SAMN17294031 |
SRA |
SRX9832864 |