|
| Status |
Public on Jul 13, 2021 |
| Title |
s_GV_Mov10l_HET_F63_r3.SE |
| Sample type |
SRA |
| |
|
| Source name |
GV oocyte_Mov10l1 HET
|
| Organism |
Mesocricetus auratus |
| Characteristics |
genotype: Mov10l1 HET
tissue: GV oocyte
age: 36 weeks
|
| Treatment protocol |
Production of knock-out hamsters was carried out using an in vivo electroporation CRISPR/Cas9 system. Pairs of sgRNAs were designed to cleave Mov10l1 genomic sequence in intron 19 (sequence of DNA targets: 5´- gggtatcacatgacttgggg – 3´; 5´- ggtgttgggatcatagtgggg – 3´) and intron 20 (sequence of DNA targets: 5´-tctccactcttccatgtgggg - 3´; 5´- taccattacatttgtcagggg - 3´) in order to delete exon 20. Five animals were born of which one did not exhibit any deletion, two appeared homozygous for the deletion and were not used for breeding, and one male and one female showed modification of one allele. The male was fertile but did not transmit the allele (# of progeny = 13; 8 males + 5 females) while the female (#4) transmitted the allele into progeny (# of progeny = 10; 3 males + 4 females carried the mutant allele) when bred to a wild type animal. Subsequent breeding of heterozygotes for two generations with wild type outbred animals was performed in order to minimize possible off-targeting and inbreeding effects when heterozygotes were mated to produce homozygotes.
|
| Growth protocol |
Fully-grown germinal vesicle-intact oocytes were collected from ovaries by puncturing antral follicles with a syringe needle in M2 medium (Sigma) containing 0.2 mM 3-isobutyl-1-methyl-xanthine (Sigma) to prevent resumption of meiosis.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Total RNA was extracted from 6 – 12 fully-grown oocytes using Arcturus Picopure RNA isolation kit (Thermo Fisher) according to the manufacturer’s protocol.
RNA-seq libraries were generated using the Ovation RNA-Seq system V2 (NuGEN) followed by Ovation Ultralow Library system (DR Multiplex System, NuGEN) according to the manufacturer’s protocol. cDNA fragmentation was performed on Bioruptor sonication device (Diagenode) with 30 s ON, 30 s OFF for 18 cycles on low intensity. Libraries were amplified by 9 cycles of PCR and sequenced by 100 nt single-end reading using the Illumina NovaSeq6000 platform.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Raw RNA-seq reads were mapped to golden hamster (mesAur1) and the newest golden hamster (PRJDB10770) genomes using STAR 2.7.3a with following parameters: STAR --readFilesIn $ {FILE}.fastq.gz --genomeDir $ {GENOME_INDEX} --runThreadN 12 --genomeLoad LoadAndRemove --limitBAMsortRAM 20000000000 --readFilesCommand unpigz –c --outFileNamePrefix $ {FILENAME} --outSAMtype BAM SortedByCoordinate --outReadsUnmapped Fastx --outFilterMultimapNmax 5000 --winAnchorMultimapNmax 5000 --seedSearchStartLmax 30 --alignTranscriptsPerReadNmax 30000 --alignWindowsPerReadNmax 30000 --alignTranscriptsPerWindowNmax 300 --seedPerReadNmax 3000 --seedPerWindowNmax 300 --seedNoneLociPerWindow 1000 --outFilterMultimapScoreRange 0 --outFilterMismatchNoverLmax 0.05 --sjdbScore 2 For analysis of expression of protein coding genes, reads were mapped with maximum of 20 multimapping alignments allowed.
Reads mapped to mesAur1 were counted over exon features annotated by Ensembl (release 99) using featureCounts v2.0.0: featureCounts -a $ {FILE}.gtf -o $ {FILE}.counts.txt $ {FILE}.bam -T 12 -F GTF -M -O –fraction
Genome browser coverage tracks in bigWig format were produced using bedtools v2.26.0 and wigToBigWig v 4 from UCSC: genomeCoverageBed -ibam ${FILE}.bam -bg -split -g chrNameLength.txt > ${FILE}.bedGraph wigToBigWig ${FILE}.bedGraph chrNameLength.txt ${FILE}.bw
Genome_build: MesAur1.0
Supplementary_files_format_and_content: ensembl.99.MesAur1.0.Piwil3_Tex101.from_RefSeq.raw_counts.oocyte.txt: tab delimited table with counts of reads over exon coordinats from Ensembl Release 99 .gtf file with added Piwil3 and Tex101 annotated by RefSeq; samples are in columns, genes in rows
Supplementary_files_format_and_content: Coverage genome browser tracks files: bigWig format generated in a non-stranded mode, not normalized for library size
|
| |
|
| Submission date |
Jan 12, 2021 |
| Last update date |
Jul 14, 2021 |
| Contact name |
Filip Horvat |
| E-mail(s) |
filip.horvat@img.cas.cz
|
| Organization name |
Institute of Molecular Genetics of the ASCR
|
| Lab |
Laboratory of Epigenetic Regulations
|
| Street address |
Videnska 1083
|
| City |
Prague |
| ZIP/Postal code |
14220 |
| Country |
Czech Republic |
| |
|
| Platform ID |
GPL28997 |
| Series (2) |
| GSE164656 |
Golden hamster piRNAs are essential for early development and establishment of spermatogonia [hamster_oocyte.RNA_seq] |
| GSE164658 |
Golden hamster piRNAs are essential for early development and establishment of spermatogonia. |
|
| Relations |
| BioSample |
SAMN17293985 |
| SRA |
SRX9832884 |
