|
| Status |
Public on Mar 01, 2010 |
| Title |
small RNAs-parthenogenetic |
| Sample type |
SRA |
| |
|
| Source name |
parthenogenetic colony
|
| Organism |
Acyrthosiphon pisum |
| Characteristics |
strain: LSR1
|
| Treatment protocol |
none
|
| Growth protocol |
The LSR1 clone of the pea aphid was reared and maintained as parthegonetic individuals on the plant vicia fabae at 18°C under 16h photoperiod.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from a mixed culture of parthenogenetic females of the LSR1 clone [15] of pea aphid using PureZOL RNA Isolation Reagent (Bio-Rad, Hayward CA). The RNA concentration and purity were determined photometrically by measuring absorbance at 260 nm and A260/A280 ratio using the NanoDrop ND-1000 spectrophotometer (Nanodrop Technologies). 40µg of ethanol precipitated RNA was sent in duplicate to Illumina Inc. (Hayward CA) for size fractionation (<50bp) and deep sequencing.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
n/a
|
| Data processing |
unique_quant.fa includes unredundant sequences with quantification (the postfix number corresponds to the number of times the sequence has been found in the sample). for example : >quant-1_x24329 AAATTCGGTTCTAGAGAGGTTT has been found 24329 times
|
| |
|
| Submission date |
Jan 29, 2010 |
| Last update date |
May 15, 2019 |
| Contact name |
Stephanie Jaubert |
| E-mail(s) |
stephanie.jaubert@rennes.inra.fr
|
| Organization name |
INRA
|
| Lab |
UMR BiO3P
|
| Street address |
domaine de la Motte
|
| City |
Rennes |
| ZIP/Postal code |
35653 |
| Country |
France |
| |
|
| Platform ID |
GPL9994 |
| Series (2) |
| GSE20107 |
Phenotypic plasticity in the pea aphid Acyrthosiphon pisum: miRNA sequencing |
| GSE20110 |
Phenotypic plasticity in the pea aphid Acyrthosiphon pisum |
|
| Relations |
| SRA |
SRX016814 |
| BioSample |
SAMN00008956 |
