 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 07, 2021 |
| Title |
VIR_CXCdrome DIP 1 |
| Sample type |
SRA |
| |
|
| Source name |
S2 cells sheared genomic DNA
|
| Organism |
Drosophila melanogaster |
| Characteristics |
ip target: MSL2 virCXCdrome
assay type: DIP
experimental series: 2
|
| Treatment protocol |
Cells were transfected with the plasmid of interest plus 1:20 of pCoBlast (Thermo Fischer, Cat. No K5150-01) using Effectene transfection reagent (QIAgen, Cat. No 301425). 72h after transfection cells were diluted 2-3 times and Blasticidin was added to the medium at a final concentration of 50ng/ul for 7 or 10 days. For the DIP experiments in presence of RNA we pre-incubated the recombinant proteins with different amount of RB4 (GGUUAACGUUAUACAAGCCGAG) or ctrl (GACGUUGUAAUAUGUACGGGAU) RNA oligos and proceeded with the normal DIP protocol.
|
| Growth protocol |
D. melanogaster embryonic Kc167 cell line was obtained from the Drosophila Genomic Resource Center (https://dgrc.bio.indiana.edu/Home). D. melanogaster S2 (subclone L2-4) cell line was a kind gift of P Heun (Villa et al., 2016). D. virilis 79f7Dv3 cell line was a kind gift of BV Adrianov (Albig et al., 2019). The identity of cell lines was verified by high-throughput sequencing. Cells were subjected to mycoplasma testing. Cells were maintained at 26°C in Schneider’s Drosophila Medium (Thermo-Fischer, Cat. No 21720024) supplemented with 10% FBS (Kc167 and S2) or 5% FBS (79f7Dv3) and 1% Penicillin-Streptomycin solution (Sigma-Aldrich, Cat No P-4333). Spodoptera frugiperda 21 (SF21) cells (Gibco) were used for amplification of recombinant baculoviruses and baculovirus-driven expression of recombinant proteins. SF21 cells were cultured at 26°C in Sf-900 II medium (Gibco) supplemented with 10% fetal calf serum and gentamycin.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Pellet from 6 × 107 S2 or virilis cells was suspended in 1.2 ml of lysis buffer (10 mM Tris pH 8, 100 mM NaCl, 25 mM EDTA pH 8, 0.5% SDS, 0.15 mg/ml of proteinase K) and incubated at 56°C overnight. After addition of sodium acetate to a final concentration of 0.3 M, the nucleic acids were extracted with phenol–chloroform and precipitated with an equal volume of isopropanol at −20°C for 1 h. Precipitated nucleic acids were centrifuged and washed with 70% ethanol. Dried pellets were resuspended in TE buffer and sonicated with Covaris AFA S220 (microTUBEs, Peak Incident Power 175 W, Duty Factor 10%, Cycles per Burst 200, 430 s) to generate 200 bp fragments. After RNAse digestion (0.1 mg/ml, 1 h at 37°C), DNA was purified with the GenElute kit (Sigma-Aldrich). DNA immunoprecipitation (DIP) experiments were performed as in (Villa et al. 2016) with few modifications. Briefly, 400 ng of genomic DNA (gDNA) was incubated with 80nM of recombinant proteins at 26°C for 30 min in 100 μl of binding buffer (100 mM KCl, 2 mM MgCl2, 2 mM Tris–HCl pH 7.5, 10% Glycerol, 10 μM ZnCl2). Ten percent of the reaction was taken as input material. DNA–protein complexes were immunoprecipitated using 30 μl of anti-FLAG M2 beads (SIGMA) and washed twice with 100 μl of binding buffer to eliminate unbound DNA. After proteinase K digestion (0.5 mg/ml, 1 h at 56°C), DNA was purified with AMPure beads (Beckman Coulter).
Libraries for sequencing were prepared using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, E7465).
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Data processing |
Sequencing reads were aligned to the dm6 version of the D. melanogaster genome using bowtie2 (version 2.3.5) allowing only unique matches
Coverage vectors were generated by counting overlapping fragments at each genomic position
Genome_build: dm6 (mel) and caf1 (vir)
Supplementary_files_format_and_content: bigwig files with coverage
|
| |
|
| Submission date |
Jan 29, 2021 |
| Last update date |
Jul 07, 2021 |
| Contact name |
Tobias Straub |
| E-mail(s) |
tstraub@med.uni-muenchen.de
|
| Organization name |
LMU Munich
|
| Department |
Biomedical Center, Bioinformatics
|
| Street address |
Großhadener Str. 9
|
| City |
Martinsried |
| ZIP/Postal code |
82152 |
| Country |
Germany |
| |
|
| Platform ID |
GPL19951 |
| Series (1) |
| GSE165833 |
Diverging principles of selective sex chromosome regulation during evolution of Drosophila |
|
| Relations |
| BioSample |
SAMN17714596 |
| SRA |
SRX9986141 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5050780_VIR_CXCdrome_6_2_TTAGGCAT_1_coverage.bw |
86.6 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
