 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 04, 2021 |
| Title |
Neuro-2A_SUPT16_10Q |
| Sample type |
SRA |
| |
|
| Source name |
Neuroblast cells
|
| Organism |
Mus musculus |
| Characteristics |
cell type: Neuro-2a cells
treatment: Transfected with plasmids encoding ataxin-7 10Q, spCas9 and sgRNA for site 2 from PX458
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
5 million murine Neuro2a cells were transfected with 10QATXN7 or 92Q-ATXN7 and co-transfected with a plasmid expressing sgRNA to a designated target site on Chromosome 14 (site 1: GGTAGACATCAGCGCTGTTG, site 2: CTCGCAGCCCTCCACCGTAA), along with CRISPR-Cas9 and a constitutive GFP reporter. For the quality control experiment, only the CRISPR-Cas9 plasmid co-expressing site 2 targeted sgRNA or non-targeted sgRNA were used. 48 hrs after transfection, cells were trypsinized for 5 min, rinsed in PBS, and three replicates were pooled. 1 million GFP positive cells per pooled condition were sorted by flow cytometry. Cells were then resuspended in 200 μl PBS and 20 μl NEB Proteinase K (800U/mL) and incubated for 30 min at 56°C. Proteinase K was inactivated by heating at 95°C for 5 min and then 5 µl RNaseA (8mg/ml) was added and incubated for 30 min at 37°C. Treated lysate was purified using the Qiagen Blood and Tissue DNA Kit using the manufacturer’s protocol, with the final elution performed twice with 100 µl AE buffer.
A Diagenode Bioruptor Pico was used to shear DNA to 750 bp fragments. Each sample was then bait-amplified using using Phusion DNA polymerase (ThermoFisher #F530L) in standard reactions containing biotinylated bait primers (site 1: /5Biosg/ACTAAAAAGAGCGCCCCTCTTTC, site 2: /5Biosg/GGTTTCCCCTCCGCTCTTTA). The Invitrogen PureLink PCR Cleanup Kit was used to remove excess RNA and biotinylated primer. 50 µl 5M NaCl and 2.5 µl 0.5M EDTA pH 8 were added to each sample. Biotinylated bait DNA was then purified using magnetic C1 Streptavidin Dynabeads (ThermoFisher #11205D). Bead-DNA complexes were washed and resuspended in water and then the following was added for an on-bead ligation reaction: 10 µl 10X T4 ligase buffer, 5 µl 20mM hexamine cobalt III chloride (Sigma #481521), 5 µl bridge adapters as per reference, 5 µl3U/µl T4 DNA ligase (NEB #M0202S), and 30 µl 50% PEG8000 (Promega #V3011) in water. A thermal cycler was used for the ligation reaction using settings of 1 hr at 25°C, 1 hr at 22°C, a manual pipette resuspension step, 1 hr at 22°C, and 16 hrs at 16°C. Ligation product was then washed by first adding 100 µl 2X B&W buffer per sample, captured on magnets, and then washing with 200 µl 1X B&W buffer twice followed by a 200 µl water wash. LpnPI digestion was performed on indicated samples using beads resuspended in 23.5 µl water, 3 µl 10X NEB Cutsmart buffer, 0.5 µl of 100 µM 5-Cytosine methylated primer (site 1: TTTGGGAAGAGC/iMe-dC/TGAGCATTCTGAG, site 2: TCAACCCCGTCCC/iMedC/AGTGGAAAACACCC), 0.5µl LpnPI enzyme (NEB #R0663S), 1 µl 30X enzyme activator, at running conditions of 37°C for 4 hrs, then 65°C heat inactivation for 20 min. LpnPI digested samples were washed with 600 µl B&W buffer 5x, then once with 1 mL water, and resuspended in 200 µl water. For Illumina adapter inclusion and barcoding, resuspended samples were split into 8 PCR reactions consisting of 10 µl 5X Phusion buffer, 4 µl 2.5mM dNTPs, 2 µl 10µM I5 nested primer, 2 µl 10µM I7 primer, 0.5 µl Phusion polymerase, 25 µl bead-DNA complex, and 6.5 µl water. Reaction was run using 95°C 30 sec, 18 cycles of 95°C 15 sec, 60°C 30 sec, 72°C 1 min, then 72°C 6min, and ending with 4°C until removed from thermal cycler. PCR products were pooled and removed of beads by extraction of supernatant on magnet followed by centrifugation at 15,000g for 5 min at RT. Supernatant was transferred to a new tube and purified using the Invitrogen PureLink PCR Cleanup Kit with Buffer 2 conditions and eluted with 60 µl water. Final Illumina binding adapters were added by 4 PCR reactions of P5-I5 and P7-I7 adapter primers, using the following conditions: 15 µl DNA products, 16.5 µl water, 10 µl 5X Phusion buffer, 4 µl 2.5mM dNTPs, 2 µl of each 10 µM P5-I5 and P7-I7 primer, 0.5 µl Phusion polymerase, with running conditions of 95°C 3min, 16 cycles of 95°C 15 sec, 62°C 30 sec, 72°C 1 min, then 72°C 6 min, and 4°C until removal from thermal cycler. Final purification of library prior to NGS steps was performed by running on a 1X TBE gel containing GelRed stain (VWR #89139-134), excised in the 350-1,250bp range (directly above primer-dimer band), and extracted using a Qiagen gel purification kit. Additional purification was performed from the gel purification by a second purification through the Invitrogen PureLink PCR Cleanup Kit with Buffer 2 conditions and eluted with 30 µl water. Library concentration was estimated using a NanoDrop, and library pools were created using equimolar DNA per sample. Finally, libraries were run on an Illumina MiSeq at 300 bp depth (QC reads, P5-I5-end only) or 250bp depth (experimental reads, P5-I5 end only).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Library strategy: LAM-HTGTS
For QC analysis, FASTQ files for each barcode were processed in R using vmatchPattern function in Biostrings. The pattern aligned to was: “AACCGCTTCAGCTTGGTGTAGACGGTGTGCAAGCCCCCCA”, which contains the nested primer, 20 bp downstream genomic sequence, and is 63 bp upstream of the CRISPR-Cas9 cleavage site, allowing up to 3 mismatches
To determine indels, we only counted reads that contained the sequence “TGGCCCCTCTCAGATCCACCATTTTGCACTCATTATTCTG” and were not isogenic to the reference sequence in length. This sequence allows for up to 15 bp deletion indels distal to the cut site (up to 63+15bp total indel), since the sequence begins 15 bp distal to the cut site.
Reads which were not indels were separately saved, trimmed by 110 bp (the region containing the nested primer up to the CRISPR-Cas9 cut site), and then end-end aligned to mm10 using Bowtie2 in Galaxy
Aligned BAM files were converted to BED files using BAM to BED in Galaxy. All reads within 50 kb of the bait Cas9 cleavage site were designated “local” translocations, and all reads on other chromosomes or >50 kb from the bait site were considered “distal” translocations.
For the 10Q vs 92Q ATXN7 analysis, FASTQ files were similarly processed. For site 1 analysis, the initial vmatchPattern alignment was “GTTGAAGACCTCAGAGGTGATGCTGGCTGCTTTCTTCATC”, which contains the nested primer, 20 bp downstream genomic sequence, and is 40 bp upstream of the CRISPR-Cas9 cut site.
To determine indels, we counted reads that contained the sequence “TGTCTACCTGTAGCAAGGTGATGCATTTCTACTACACACA” and were not isogenic to the reference sequence in length. As for site 2, this sequence allows for up to 15 bp deletion indels distal to the cut site (up to 40+15bp total indel), since the sequence begins 15 bp distal to the cut site
The remainder of the analysis was identical to the QC analysis with translocations defined as “distal”, i.e. >50 kb away from cut site translocations.
To determine overlap with mm10 annotations BED files for each, corresponding annotation was downloaded from the UCSC genome browser (exons, intron, ChIP-Seq hit genes) or supplemental data files. Any discrepancy from mm9 and mm10 genomes was first converted using the LiftOver function of the UCSC genome browser. To create a randomized control “expect” rate, BED locations were permuted 1000x over the mm10 chromosomal genome.
Genome_build: mm10
Supplementary_files_format_and_content: Peak text files
|
| |
|
| Submission date |
Feb 03, 2021 |
| Last update date |
Feb 05, 2021 |
| Contact name |
Pawel Michal Switonski |
| Organization name |
University of California, Irvine
|
| Department |
Department of Pathology & Laboratory Medicine
|
| Lab |
La Spada
|
| Street address |
1001 Health Sciences Road
|
| City |
Irvine |
| State/province |
California |
| ZIP/Postal code |
92697 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE166119 |
Genome-wide Translocation Analysis in the 266Q Knock-in Mouse Model of SCA7 |
| GSE166123 |
Epigenetic dysregulation impairs high-fidelity DNA repair to promote cerebellar degeneration in spinocerebellar ataxia type 7 |
|
| Relations |
| BioSample |
SAMN17771895 |
| SRA |
SRX10015179 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5061965_Supt16_10Q_endend_offcut_translocations.txt.gz |
1.5 Kb |
(ftp)(http) |
TXT |
| GSM5061965_Supt16_10Q_endend_oncut_translocations.txt.gz |
809 b |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
