NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5114317 Query DataSets for GSM5114317
Status Public on Jun 28, 2021
Title [ChIP-seq] B. anthracis 34F2 AtxA-1xFLAG #1 enriched
Sample type SRA
 
Source name B. anthracis 34F2 AtxA-1xFLAG
Organism Bacillus anthracis
Characteristics strain: BYF10078
genotype: B. anthracis 34F2 AtxA-1xFLAG
chip antibody: Anti-FLAG M2 affinity gel
Growth protocol A colony of the strain grew on BHI plate at 37°C for overnight was inoculated into NBY medium supplemented with 8% NaHCO3, followed by shaking at 37°C under 15% CO2 for 3 h. 100-fold diluted in NBY medium supplemented with NaHCO3 and cultured at 37°C under 15% CO2 for 3 h.
Extracted molecule genomic DNA
Extraction protocol [ChIP-seq] Cells were pelleted and treated with 1% formaldehyde for for crosslinking. 250 mM glycine was added for quenching. After pelleting and resuspension in lysis buffer with cOmplete Mini Protease Inhibitor Cocktail, the samples were sonicated using Covaris S2. Supernatants were combined with Anti-FLAG M2 affinity gel for enrichment, followed by wash and protease K treatment at 65°C. [Cappable-seq] RNA was extracted using TRIzol after incubating the pellet with 2% SDS. After removing DNA with DNA-free DNA removal kit, RNA samples followed the protocol described before (Ettwiller et al, BMC Genomics 17:199, 2016) [3´-RACE] RNA was extracted using TRIzol after incubating the pellet with 2% SDS. DNA was removed with DNA-free DNA removal kit. [RNA-seq] RNA was extracted using TRIzol after incubating the pellet with 2% SDS. DNA was removed with DNA-free DNA removal kit. rRNA was depleted by the protocol described before (Culviner et al, mBio, 2020), followed by fragmentation with the treatment with a divalent cation and heat.
[ChIP-seq] Library was constructed with NEBNext Ultra II DNA Library Prep Kit for Illumina. [Cappable-seq, 3´-RACE, and RNA-seq] Library was constructed with NEBNext Multiplex Small RNA Library Prep Set for Illumina.
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model Illumina MiSeq
 
Data processing [ChIP-seq] Sequence reads were applied for adapter trimming and quality filtering using Trim Galore! version 0.6.4_dev with the option "-a GATCGGAAGAGCACACGT", followed by mapping to the genome sequence of B. anthracis Ames ancestor strain (RefSeq assembly accession no. GCF_000008445.1 with manual modification for sequence difference in xrrC) using BWA-mem 0.7.17. The mapping data was applied for R package csaw 1.22.1 with 158 bp of fragment length and 50 bp of window width.
[Cappable-seq] For the analysis of sequence reads, adapter sequence was removed using cutadapt 2.1 with the option "-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", followed by mapping to the genome sequence of B. anthracis Ames ancestor (RefSeq assembly accession no. GCF_000008445.1 with manual modification for sequence difference in xrrC) using Bowtie2 2.3.5 with the option "-L 16". Coverage of the first base of mapped reads was calculated for each position with considering strands.
[3´-RACE] Reads were mapped to B. anthracis Ames ancestor (RefSeq assembly accession no. GCF_000008445.1 with manual modification for sequence difference in xrrC) using BWA-backtrack 0.7.17.
[RNA-seq] Reads were trimmed using Trim Galore! 0.6.4_dev with the option "-a AGATCGGAAGAGA", mapped to B. anthracis Ames ancestor (RefSeq assembly accession no. GCF_000008445.1 with manual modification for sequence difference in xrrC) using BWA-mem 0.7.17, and tag counted with htseq-count.
 
Submission date Feb 27, 2021
Last update date Jun 29, 2021
Contact name Yoshikazu Furuta
E-mail(s) yfuruta@czc.hokudai.ac.jp
Organization name Hokkaido University
Department International Institute for Zoonosis Control
Lab Division of Infection and Immunity
Street address North 20 West 10, Kita-ku
City Sapporo
State/province Hokkaido
ZIP/Postal code 001-0020
Country Japan
 
Platform ID GPL29781
Series (1)
GSE167871 Direct regulons of the master virulence regulator AtxA of Bacillus anthracis
Relations
BioSample SAMN18084045
SRA SRX10185359

Supplementary file Size Download File type/resource
GSM5114317_FLAGen1_2ndand3rd_BanAA_sorted_count.txt.gz 606.5 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap