|
| Status |
Public on Jun 01, 2010 |
| Title |
Liver_double_gel_day2_rep2 |
| Sample type |
RNA |
| |
|
| Source name |
liver, double gel, day 2
|
| Organism |
Rattus norvegicus |
| Characteristics |
culture type: collagen sandwich
day: 2
cell type: hepatocyte
|
| Growth protocol |
Hepatocytes were cultured on collagen-coated 6-well sterile tissue culture plates (Becton Dickinson Labware, Franklin Lakes, NJ) and were maintained in culture medium that consisted of DMEM supplemented with 10% heat-inactivated fetal bovine serum (Hyclone, UT) 200 U/mL penicillin, 200 μg/mL streptomycin, 20 ng/mL epidermal growth factor (BD Biosciences, San Jose, CA) 0.5 U/mL insulin (USP, Rockville MD) , 14 ng/mL glucagon and 7.5 μg/mL hydrocortisone. A collagen gelling solution was prepared by mixing 9 parts of type I collagen (BD Biosciences) solution and 1 part of 10X DMEM. Sterile 6-well tissue culture plates were coated with 0.5 ml of the gelling solution and incubated at 37 oC for 1h to promote gel formation. Isolated hepatocytes were suspended in hepatocyte culture medium at a concentration of 1x106 cells/ml and seeded on the collagen-coated wells at a density of 1 million cells/well. Collagen sandwich cultures were formed by the deposition of a second layer of collagen 24h later. Hepatocytes maintained in stable collagen sandwich and in unstable confluent monolayer cultures served as positive and negative controls, respectively. Hepatocyte cultures were maintained at 37°C in a humidified gas mixture of 90% air/10% CO2. The culture medium was replaced every 24 hours.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Primary rat hepatocytes cultured in CS and HM cultures were maintained for an eight-day culture period. On days 1, 2, 3 and 8 after deposition of second layer of collagen gel on hepatocytes, total RNA was extracted and purified from cells for each culture system using RNeasy mini kit (QIAGEN, Valencia, CA) according to manufacturer’s protocol.
|
| Label |
biotin
|
| Label protocol |
Isolated RNA samples in triplicate at each time point were labeled according to the Affymetrix Standard Target labeling process. Briefly, total RNA was converted into double-stranded complementary DNA using a T7- oligo (dT) primer (5’ – GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG–(dT)24 –3’) and reverse transcription. Synthesized cDNA was converted into biotinylated cRNA by transcription using T7 RNA polymerase.
|
| |
|
| Hybridization protocol |
Randomly fragmented cRNA was hybridized to GeneChip Rat Genome 230 2.0 array (Affymetrix, Santa Clara, CA), and the arrays were washed and stained according to Affymetrix’s ptotocols.
|
| Scan protocol |
The arrays were scanned using an Affymetrix 7G scanner according to Affymetrix’s ptotocols.
|
| Description |
Rat hepatocytes grown between two layers of collagen gel, collected on day 2 after deposition of second layer of collagen gel
|
| Data processing |
The BioConductor package for R was used to perform initial statistical analysis of the DNA microarray data. The data from 24 chips (2 culture conditions × 4 time points × 3 replicates) were normalized using the Robust Multichip Average method and used for further analysis. The affylmGUI interface to Linear Models for Microarray Data (LIMMA) was used to perform differential gene expression analysis. For each contrast, LIMMA was used to compute a p-value for each probe set that indicated the statistical significance of the difference of the expression levels of that probe set between the two conditions in the contrast.
|
| |
|
| Submission date |
Mar 05, 2010 |
| Last update date |
May 14, 2010 |
| Contact name |
Chris Lasher |
| E-mail(s) |
lasher@vt.edu
|
| Organization name |
Virginia Polytechnic and State University
|
| Department |
Genetics, Bioinformatics, and Computational Biology
|
| Lab |
Murali
|
| Street address |
103 Lucas Dr Apt B
|
| City |
Blacksburg |
| State/province |
VA |
| ZIP/Postal code |
24060 |
| Country |
USA |
| |
|
| Platform ID |
GPL1355 |
| Series (1) |
| GSE20659 |
A Comparative Study of Genome Wide Transcriptional Profiles of Primary Hepatocyte in In Vitro Cultures |
|
