 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 03, 2023 |
| Title |
P10_set2_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
Skin
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Normal Skin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For Visium, two sections per patient were cut at 10 µm thickness and mounted onto Visium slide capture areas. Sequencing libraries were prepared following the manufacturer’s protocol, again with the Hematoxylin staining time adapted to 4 minutes. After tissue staining, bright-field images were taken as described in the Spatial Transcriptomics procedure. Tissue permeabilization was performed for 14 minutes, as established in the TO assay.
The Visium Spatial Gene Expression Slide & Reagent kit (10X Genomics) was used to generate sequencing libraries for Visium samples.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
P10_set2_rep2
|
| Data processing |
library strategy: Spatial Transcriptomics
Libraries were sequenced on NextSeq2000 (Illumina) with a 28-10-10-150 setup (for patient 3 and patient 10 Set 1) and NovaSeq6000 (Illumina) with a 28-10-10-120 setup (patient 10 Set 2). Between 218 and 346 million raw reads were generated per sample. Following demultiplexing of bcl files, read 2 fastq files were trimmed using Cutadapt (Martin, 2011) to remove full-length or truncated template switch oligo (TSO) sequences from the 5’ end (beginning of read 2) and polyA homopolymers from the 3’ end (end of read 2). The TSO sequence (AAGCAGTGGTATCAACGCAGAGTACATGGG) was used as a non-internal 5’ adapter with a minimum overlap of 5, meaning that partial matches (up to 5 base pairs) or intact TSO sequences were removed from the 5’ end. The error tolerance was set to 0.1 for the TSO trimming to allow for a maximum of 3 errors. For the 3’ end homopolymer trimming, a sequence of 10 As was used as a regular 3’ adapter to remove potential polyA tail products regardless of its position in the read, also with a minimum overlap of 5 base pairs. The trimmed data was processed with the spaceranger pipeline (version 1.0.0, 10X Genomics) and mapped to the GRCH38 v93 genome assembly.
Genome_build: GRCh38 v93
Supplementary_files_format_and_content: 10X spaceranger v1.0.0 pipeline outputs from /filtered_feature_bc_matrix/ and /spatial/ folders including genes by barcode counts matrices (.mtx, .tsv), PNG of all replicate images, JSON of scaling factors, and Visium tissue position lists per replicate (.csv)
|
| |
|
| Submission date |
Apr 30, 2021 |
| Last update date |
May 06, 2023 |
| Contact name |
Andrew Ji |
| E-mail(s) |
andrew.ji@mssm.edu
|
| Organization name |
Icahn School of Medicine at Mount Sinai
|
| Street address |
1428 Madison Ave.
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10029 |
| Country |
USA |
| |
|
| Platform ID |
GPL30173 |
| Series (1) |
| GSE173651 |
Single-cell and spatial transcriptomic analysis of homeostatic adult human skin |
|
| Relations |
| BioSample |
SAMN18935374 |
| SRA |
SRX19141759 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5273015_P10_set2_rep2_aligned_fiducials.jpg.gz |
1.5 Mb |
(ftp)(http) |
JPG |
| GSM5273015_P10_set2_rep2_barcodes.tsv.gz |
14.2 Kb |
(ftp)(http) |
TSV |
| GSM5273015_P10_set2_rep2_detected_tissue_image.jpg.gz |
1.9 Mb |
(ftp)(http) |
JPG |
| GSM5273015_P10_set2_rep2_features.tsv.gz |
297.6 Kb |
(ftp)(http) |
TSV |
| GSM5273015_P10_set2_rep2_matrix.mtx.gz |
10.0 Mb |
(ftp)(http) |
MTX |
| GSM5273015_P10_set2_rep2_scalefactors_json.json.gz |
180 b |
(ftp)(http) |
JSON |
| GSM5273015_P10_set2_rep2_tissue_hires_image.png.gz |
4.5 Mb |
(ftp)(http) |
PNG |
| GSM5273015_P10_set2_rep2_tissue_lowres_image.png.gz |
499.1 Kb |
(ftp)(http) |
PNG |
| GSM5273015_P10_set2_rep2_tissue_positions_list.csv.gz |
57.7 Kb |
(ftp)(http) |
CSV |
SRA Run Selector |
| Raw data not provided for this record |
| Processed data provided as supplementary file |
|
|
|
|
 |
