|
| Status |
Public on Jun 27, 2022 |
| Title |
CF_Hypoxia_1 |
| Sample type |
SRA |
| |
|
| Source name |
Cardiac Fibroblasts
|
| Organism |
Rattus norvegicus |
| Characteristics |
cell type: Neonatal Rat Primary Cardiac Fibroblasts
strain: Sprague Dawley
treatment: Hypoxia with glucose and serum free medium for 5 hours
sample type: Cells
|
| Treatment protocol |
For glucose and serum deprivation (GSD) treatment, HEK and Bewo cells were cultured in glucose free DMEM basal medium for 24 hours; CF and CM cells were exposed to glucose free DEME basal medium for 5 hours. For hypoxia treatment, HEK and Bewo cells were fed with complete medium and maintained in hypoxia chamber with 0.2% oxygen for 24 hours; CF and CM cells were fed with glucose free DMEM basal medium and maintained in hypoxia chamber with 0.2% oxygen for 5 hours. For oxidative stress, HEK and Bewo cells were treated with 0.7mM H2O2 and 1.7 mM H2O2 in complete medium for 24 hours; CF and CM cells were exposed to hypoxia treatment for 5 hours and then fed with complete medium in normal incubator for additional 24 hours. FBS and horse serum used here were extracellular vesicle-depleted by 24 hours of ultracentrifugation.
|
| Growth protocol |
HEK293 cells and cardiac fibroblasts (CFs) were grown in DMEM medium containing 10% FBS and 1% Pen/Strep; Bewo cells were maintained in F12K medium containing 10% FBS and 1% Pen/Strep; cardiomyocytes (CMs) were cultured in DMEM meidum containing 10% horse serum, 5% FBS and 1% Pen/Strep.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cellular total RNAs were isolated by using TRIzol™ and then small RNAs were extracted by using mirVana™ miRNA Isolation Kit; extracellular RNAs were extracted by using exoRNeasy Midi kit.
Small RNAs were sequentially treated with DNase I, T4 PNK, and His-AlkB and then subjected to NEBNext® Multiplex Small RNA Library Prep Set for Illumina®.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
small RNAs
|
| Data processing |
Library strategy: ARM-seq
Adapters were removed and reads were merged with SeqPrep [John st. John unpub] using a minimum read length of 15 and adapters AGATCGGAAGAGCACACGTC and GATCGTCGGACTGTAGAACTC. Reads that could not be merged were discarded before mapping.
Data were analyzed with tRAX (http://trna.ucsc.edu/tRAX/), tRAX maps reads using bowtie2 v2.3.5.1 with parameters --very-sensitive --ignore-quals --np 5 -k 100, to a custom database containing mature tRNA transcripts and the genome sequence.
ENSEMBL (release 96) small ncRNA annotations were used to count the number of small RNA transcripts using only primary alignments to prevent double counting. Transcripts with 0 reads across all samples were removed.
tDRnamer (http://trna.ucsc.edu/tDRnamer/) was used to generate unique identifiers for each of the reads which mapped to a tRNA transcript based on the isodecoder(s) they mapped to and positions of any misincorporations.
DESeq2 v1.30.1 was used to generate normalized read counts for each of the transcripts across each sample.
Genome_build: Homo Sapiens GRCh38/hg38 and Rattus Norvegicus rn6
Supplementary_files_format_and_content: Processed data files are comma-separated files containing DESeq2 normalized read counts.
|
| |
|
| Submission date |
May 04, 2021 |
| Last update date |
Jun 27, 2022 |
| Contact name |
Guoping Li |
| E-mail(s) |
gli21@mgh.harvard.edu
|
| Organization name |
Massachusetts General Hospital
|
| Department |
CVRC
|
| Lab |
Dr. Saumya Das
|
| Street address |
Cardiovascular Research Center, 185 Cambridge St, Simches 3.5000
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02114 |
| Country |
USA |
| |
|
| Platform ID |
GPL18694 |
| Series (1) |
| GSE173806 |
Cellular and extracellular tRNA-derived fragments demonstrate distinct signatures in cellular stress |
|
| Relations |
| BioSample |
SAMN19006699 |
| SRA |
SRX10767886 |
