 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 19, 2021 |
| Title |
E08_MS273_222 |
| Sample type |
SRA |
| |
|
| Source name |
Cynomolgus monkey embryo E08
|
| Organism |
Macaca fascicularis |
| Characteristics |
tissue: embryo
developmental stage: E08
sequencer: Nextseq550, High, 75 cycle
|
| Growth protocol |
For cultivation of CMK6 and CMK9 cyESCs, they were cultured with conventional hESC medium [DMEM/F12 supplemented with 20% (vol/vol) of KSR, 1 mM of sodium pyruvate, 2 mM of GlutaMax, 0.1 mM of non-essential amino acids, 0.1 mM of 2-mercaptoethanol, 1000 U/ml of ESGRO mouse LIF, and 4 ng/ml of recombinant human bFGF] on mouse embryonic feeders (MEFs).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For SC3-seq analysis, cDNA synthesis / amplification from single cells and library construction from the cDNAs were performed as described previously [Nakamura et al. 2015, NAR, 43, e60; Ishikura et al. 2016, Cell Reports, 17, 2789].
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
Single cell transcriptome of amplified cDNA from cynomolgus monkey embryo at E08
|
| Data processing |
All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-e 0.1 -q 20 -n 2 -O 1 -m 30 -a CTCGAGGGCGCGCCGGATCC -g CTCGAGGGCGCGCCGGATCC -a AAAAAAAAAAAAAAAAAAAA -a TTTTTTTTTTTTTTTTTTTT". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the Cynomolgus monkey genome Macfac5.0 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—max-mle-iterations 50000", “—no-length-correction” and “—library-type fr-secondstrand” options and macfas5.0 reference gene annotations with extended TTSs. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Genome_build: Macaca fascicu;aris 5.0
Supplementary_files_format_and_content: tab-delimited text files *rpm.txt include RPM values (cufflinks) or *count.txt include Read counts (HTSeq) for each Sample
|
| |
|
| Submission date |
Jun 24, 2021 |
| Last update date |
Nov 19, 2021 |
| Contact name |
Yukihiro Yabuta |
| E-mail(s) |
yabyab@anat2.med.kyoto-u.ac.jp
|
| Organization name |
Kyoto University, Graduate school of medicine
|
| Department |
Anatomy and Cell Biology
|
| Street address |
Yoshida-Konoe-cho, Sakyo-ku
|
| City |
Kyoto |
| State/province |
Kyoto |
| ZIP/Postal code |
606-8501 |
| Country |
Japan |
| |
|
| Platform ID |
GPL27448 |
| Series (1) |
| GSE151149 |
The X-chromosome dosage compensation program during the development of cynomolgus monkeys |
|
| Relations |
| BioSample |
SAMN19858071 |
| SRA |
SRX11218965 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5398554_E08_MS273_222_count.txt.gz |
201.2 Kb |
(ftp)(http) |
TXT |
| GSM5398554_E08_MS273_222_rpm.txt.gz |
214.2 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
