|
| Status |
Public on Nov 02, 2022 |
| Title |
S28_Tn |
| Sample type |
SRA |
| |
|
| Source name |
In vitro differentiated TH2 cells transduced with sgRNA-expressing retroviruses
|
| Organism |
Mus musculus |
| Characteristics |
screen: S28
sgrna_library: Secondary
sorted_tom_phenotype: neg
|
| Growth protocol |
Splenic CD4+ TN cells from Cas9xIl13Tom mice were flow-sorted, activated with a-CD3, a-CD28 and IL-2 for 24 hr and transduced with BFP/sgRNA-expressing retroviral library. Cells were maintained in IL-2 until day 6, and then differentiated into TH2 cells. At day 9, live BFP+ Tom+ or Tom- cells were flow-purified for genomic DNA extraction
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were flow-sorted into 50% FCS PBS and genomic DNA from sorted cells were extracted using the QIAGEN DNeasy Blood & Tissue Kits following the manufacturer’s protocol, with the exception of DNA elution in water instead of buffer AE.
Illumina P7 barcodes; sgRNA-insert was first PCR-amplified using Herculase II Fusion DNA polymerase (Agilent) with primers (Forward) AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG and (Reverse) CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC, using up to 2 mg genomic DNA per 50 ml reaction. Equal volumes from each reaction were pooled and used for a further PCR amplification step to attach Illumina sequencing adaptors and Illumina P7 barcodes, using Herculase II Fusion DNA polymerase. The 330 bp library was gel purified and quantified using KAPA library quantification kit (Roche).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
processed data file:
S28_32ab_sec_lib_data.csv
S28_32ab_sec_screen_list.csv
|
| Data processing |
Samples were sequenced using an Illumina Hiseq4000 running a single-read 50bp protocol
20 nt sgRNA sequences were trimmed from backbone sequences using Cutadapt version 1.4.1 (5’ GACGAAACACCG, 3’ GTTTTAGAGCTA).
sgRNA sequences were aligned to reference sgRNA libraries using Bowtie2 (version 1.2.3).
Supplementary_files_format_and_content: sgRNA count files (lib data) and pool information (screen list).
|
| |
|
| Submission date |
Jun 30, 2021 |
| Last update date |
Nov 02, 2022 |
| Contact name |
Alastair Crisp |
| Organization name |
MRC Laboratory of Molecular Biology
|
| Street address |
Francis Crick Avenue
|
| City |
Cambridge |
| ZIP/Postal code |
CB2 0QH |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL21103 |
| Series (2) |
| GSE179206 |
Genome-wide CRISPR screen reveals a key role for integrin avb3 in TH2 cell polarisation [CRISPRscr] |
| GSE179210 |
Genome-wide CRISPR screen reveals a key role for integrin avb3 in TH2 cell polarisation. |
|
| Relations |
| BioSample |
SAMN19972789 |
| SRA |
SRX11316275 |
