 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 31, 2021 |
| Title |
pt1002310_adjNORM_CD45+_cells_scRNAseq_1 (RNA-Seq) 2 |
| Sample type |
SRA |
| |
|
| Source name |
Donor
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Adjacent normal kidney tissue
treatment: baseline
cell type: adjacent normal kidney immune cells
disease state: Early Stage ccRCC
library strategy: RNA-seq
|
| Treatment protocol |
Renal tumor and adjacent normal tissue samples were dissociated into single cells by a semi-automated mechanical and enzymatic process. Tumor tissue was cut into pieces of (~2-3 mm) in size and transferred to C Tubes (Miltenyi Biotech) containing a mix of Enzymes (Tumor Dissociation Kit, human; Miltenyi Biotech). Mechanical dissociation was performed on gentleMACS dissociator (program 37C_h_TDK_1). To allow for enzymatic digestion, the tube was incubated for 30 min at 37oC, with rotation, after the first and second mechanical dissociation step. Mononuclear cells (MNCs) from whole peripheral blood of paired subjects were isolated by density gradient centrifugation using SepMate Tubes (Stem Cell Technologies). Cells were then cryopreserved in Recovery Cell Culture Freezing Medium (ThermoFisher). Prior to single-cell sequencing cells were rapidly thawed in warm DMEM (Gibco) supplemented with 10% FBS and pelleted. Cell sorting. Tumor, adjacent normal tissue cells, and PBMCs were resuspended in FACS staining buffer (1% BSA and 1mM EDTA in DPBS; Gibco) and incubated with Human TruStain FcX (BioLegend) for 10 min on ice to block non-specific binding to Fc receptors. Cells were then washed and stained with CD45-PE-Dazzle594 (BioLegend) for 20 min on ice. Next, cells were filtered and resuspended in FACS staining buffer with addition of DNase for FACS sorting. DAPI was added to the cell suspension immediately before FACS sorting for dead cell exclusion. Live, CD45+ single cells were sorted for downstream single-cell analysis.
|
| Growth protocol |
N/A
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Single cells suspended in PBS with 0.04% BSA were loaded on a Chromium Single Cell Instrument (10x Genomics).
RNA-seq and V(D)J libraries were prepared using Chromium Single Cell 5’ Library, Gel Beads & Multiplex Kit (10X Genomics). After amplification, cDNA was split into RNA-seq and V(D)J library aliquots. To enrich the V(D)J library aliquot for TCR a/b, the cDNA was split into two 20 ng aliquots and amplified in two rounds using primers designed in-house. Specifically, for first round amplification the primers used were MP147 (ACACTCTTTCCCTACACGACGC) for short R1, MP120 (GCAGACAGACTTGTCACTGGA) for human TRAC, and MP121(CTCTGCTTCTGATGGCTCAAACA) for human TRBC. For second round amplification, 20 ng aliquots from the first round were amplified using MP147, MP128 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGGGTCAGGGTTCTGGATA) a nested R2 plus human TRAC, and MP129 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGGGTCAGGGTTCTGGATA) a nested R2 plus human TRABC. V(D)J libraries were prepared from 25 ng each hTRAC and hTRBC amplified cDNA. Paired-end sequencing was performed on Illumina NextSeq500 for RNA-seq libraries (Read 1 26-bp for UMI and cell barcode, 8-bp i7 sample index, and Read 2 55-bp transcript read) and V(D)J libraries (Read 1 150-bp, 8-bp i7 sample index, and Read 2 150-bp read). For RNA-seq libraries, Cell Ranger Single-Cell Software Suite (10X Genomics, v2.2.0) was used to perform sample demultiplexing, alignment, filtering, and UMI counting. The human GRCh38 genome assembly and RefSeq gene model for human were used for the alignment. For V(D)J libraries, Cell Ranger Single-Cell Software Suite (10x Genomics, v2.2.0) was used to perform sample de-multiplexing, de novo assembly of read pairs into contigs, align and annotate contigs against the germline segment V(D)J reference sequences from IMGT, label and locate CDR3 regions, group clonotypes.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
single cell 5' RNA expression sequencing
ccRCC_4pt_scRNAseq_CD45plus_matrix.mtx
ccRCC_4pt_scRNAseq_CD45plus_barcodes.tsv
ccRCC_4pt_scRNAseq_CD45plus_genes.tsv
ccRCC_4pt_scRNAseq_CD45plus_NormalizedCounts.txt
ccRCC_4pt_scRNAseq_CD45plus_final_UMAP_coor_cell_embedding.txt
ccRCC_4pt_scRNAseq_CD45plus_final_Metadata.txt
|
| Data processing |
Cell Ranger Single-Cell Software Suite (10X Genomics, v3.0.2) was used to perform sample demultiplexing, alignment, filtering, and UMI counting.
scRNA-seq profiles were filtered using Seurat (v3.0) as instructed, with the following criteria: nFeature_RNA > 500 & nFeature_RNA < 5000 & percent.mito < 0.25 & nCount_RNA < 50000. Cells with multiple TCR alpha or beta chains were filtered as well.
Filtered data from 4 RCC patients were integrated, clustered, analyzed and visualized following the standard dataset integration and analysis workflow in Seurat 3.0
TCR-seq data were analyzed by Cell Ranger v3.0.2 and contig sequence as well as the combination of V,D,J genes extracted
Genome_build: hg38
Supplementary_files_format_and_content: genes.tsv file, 10X gene file for raw UMI counts
Supplementary_files_format_and_content: matrix.mtx file, 10X format, raw UMI counts
Supplementary_files_format_and_content: barcodes.tsv file, 10X barcodes file for raw UMI counts
Supplementary_files_format_and_content: Metadata.txt file, phenotypic metadata for cells in dataset
Supplementary_files_format_and_content: UMAP_coor_cell_embedding.txt file, UMAP coordinates of cells in dataset, from unsupervised clustering based on gene expression profiles
Supplementary_files_format_and_content: NormalizedCounts.txt file, normalized UMI counts (data integration, library-size normalization and log-transformation with Seurat)
Supplementary_files_format_and_content: cell barcode_TCR.txt file, TCR cloneType information for Tcells in the dataset
Supplementary_files_format_and_content: filtered_contig_annoatations.csv file, filtered VDJ contig information analyzed by Cell ranger v.3.0.2
|
| |
|
| Submission date |
Jul 28, 2021 |
| Last update date |
Dec 31, 2021 |
| Contact name |
Qingqing Wang |
| E-mail(s) |
qqwang1980@gmail.com
|
| Organization name |
Regeneron Pharmaceuticals
|
| Street address |
777 Old Saw Mill River Road
|
| City |
Tarrytown |
| State/province |
NY |
| ZIP/Postal code |
10591 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE181061 |
A single-cell map of dynamic chromatin landscapes of immune cells in renal cell carcinoma (scRNA-Seq and TCR-Seq) |
| GSE181064 |
A single-cell map of dynamic chromatin landscapes of immune cells in renal cell carcinoma |
|
| Relations |
| BioSample |
SAMN20460960 |
| SRA |
SRX11593878 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
