 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 15, 2022 |
| Title |
HEK293T_SMN1W190X_gACA19_CMC |
| Sample type |
SRA |
| |
|
| Source name |
human embryonic kidney cell (HEK293T)
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
passages: 2-5
transfection: SMN1W190X and gACA19
|
| Treatment protocol |
HEK293T cells were seeded in six-well plates and incubated for 24 h, followed by co-transfection of 2 μg ALDOB-W148X (or SMN1-W190X) and 2 μg gACA19 / gCtrl / empty vector (Vec) together with or without 500 ng DKC1-isoform3 (iso3) constructs. 72 h post transfection, total RNA was extracted from cells.
|
| Growth protocol |
HEK293T cells were maintained under 5% CO2 at 37 °C in DMEM medium (Corning) supplemented with 10% FBS (Gibco) and 1% penicillin/streptomycin (Gibco)
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Total RNA was extracted from cells using TRIzol reagent (Life Technologies). The selection of polyA(+) RNA was performed using Dynabeads™ Oligo(dT)25 (Invitrogen).
RNA-seq of transfected HEK 293T cells were performed with recently developed TRACE-seq method3. Briefly, total RNA was first extracted from cells using TRIzol reagent (Life Technologies). Then, TRACE-seq libraries were constructed by seamless steps including reverse transcription by oligo dT primers, Tn5 transposase tagmentation and gap filling & PCR. After enrichment, the library was purified twice using 0.8X Agencourt AMPure XP beads (Beckman Coulter) and eluted in 10 μl nuclease-free water. The concentration of resulting libraries was determined by Qubit 2.0 fluorometer with the Qubit dsDNA HS Assay kit (Invitrogen) and the size distribution of libraries was assessed by Agilent 4150 TapeStation System with High Sensitivity D1000 ScreenTape. Finally, libraries were sequenced on the Illumina Hiseq X10 platform which generated 2 x 150 bp of paired-end raw reads. Targeted amplicon sequencing was also performed in sample 2, 4, 6, 8. The selection of polyA(+) RNA was performed using Dynabeads™ Oligo(dT)25 (Invitrogen). Then, 10 μg polyA(+) RNA was fragmented to ~200 nt at 94 ºC for 2.5 minutes using the magnesium RNA fragmentation buffer (New England Biolabs), purified by ethanol precipitation. To disrupt the RNA secondary structure, the RNA pellet was dissolved in 20 μl 5 mM EDTA, incubated at 80°C for 5 minutes, and quickly chilled on ice. Next, 10 μl denatured RNA was transferred into 100 μl in BEU buffer (50 mM Bicine, pH 8.5, 4 mM EDTA, 7 M urea) with 0.2 M CMC (Sigma, Cat#C106402, 95%) as the CMC+ sample, or into 100 μl BEU buffer as the CMC- control sample. Both CMC+ and CMC- samples were then incubated at 37 °C for 20 min, followed by purification with ethanol precipitation. The RNA pellets were then dissolved in 50 μl Na2CO3 buffer (50 mM Na2CO3 pH 10.4, 2 mM EDTA) and incubated at 37 °C for 6 h, followed by ethanol precipitation. Next, the RNA pellets were dissolved in 10 μl RNase free water. 500ng CMC-labeled RNA was mixed with 1.25 μl 100 μM Random Hexamer primers (Thermo), and the mixtures were denatured at 65°C for 5 min followed by chilling on ice. Next, 8 μl freshly prepared 2.5× reverse transcription buffer (125 mM Tris, pH 8.0, 15 mM MnCl2, 187.5 mM KCl, 1.25 mM dNTPs, 25 mM DTT) were added to the RNA-primer mixtures and the mixture were incubated at 25°C for 2 min. Then 1 μl SuperScript II reverse transcriptases (Thermo) were added, and the reactions were carried out at 25°C for 10 min, 42°C for 3 h and 70°C for 15 min. Next, the first round of on-target or off-target amplicons was PCR amplified for 15 cycles with gene-specific primers according the following reagents: 1 μl cDNA, 5 μl Q5 PCR mix (NEB), 0.4 ul of 10 μM specific primers and 3.6 μl RNase free water. And each primer pair contained a 10-nt unique molecular identifier (UMI) to enhance the accuracy. Purification of PCR products using 1.8x AMPure XP beads and then 8% TBE gel to remove the excess of primers. The purified PCR products were subjected to the second round of PCR amplification with the following primers: 5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’,5’CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC3’ (XXXXXX represents index sequence). PCR products were purified by 1.8x AMPure XP beads (backman) and then 8% TBE gel. The libraries were sequenced on Illumina Hiseq X-ten with PE 2 x 150 bp read length.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
Trim_galore (version0.6.6 http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) for quality control and adaptor trimming. The minimum quality threshold was set to 20. The remaining reads were further processed by removing the first 6nt random barcode in the 5’ end and 4nt random barcode in the 3’ end.
Processed reads were mapped to hg19 (UCSC refseq hg19).
The gene expression level was quantified as FPKM by Cufflinks.
Genome_build: hg19, UCSC Genome Browser
|
| |
|
| Submission date |
Aug 13, 2021 |
| Last update date |
Dec 15, 2022 |
| Contact name |
Kai Li |
| E-mail(s) |
li_kai@pku.edu.cn
|
| Organization name |
Peking University
|
| Department |
School of Life Science
|
| Lab |
Yi Lab
|
| Street address |
Yi He Yuan Street No.5
|
| City |
BeiJing |
| ZIP/Postal code |
100871 |
| Country |
China |
| |
|
| Platform ID |
GPL20795 |
| Series (1) |
| GSE182085 |
CRISPR-free Programmable RNA pseudouridylation to suppress premature termination codons |
|
| Relations |
| BioSample |
SAMN20774831 |
| SRA |
SRX11745849 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5518336_smn1-C.bowtie2.sam.fix.sort.bam.bw |
5.2 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
