 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 24, 2022 |
| Title |
S2_hk_STARRseq_input |
| Sample type |
SRA |
| |
|
| Source name |
whole genome library (in STARR-seq vector)
|
| Organism |
synthetic construct |
| Characteristics |
cell line: n/a
genotype: y; cn bw sp - sequenced strain (Adams et al. 2000)
sample type: PCR amplified Plasmid library
promoter: housekeeping (RpS12)
|
| Growth protocol |
Schneider 2 cells were grown in Schneider’s Medium supplemented with 10% heat inactivated FBS (Sigma; F7524) at 27ºC. Cells were passaged every 2-3 days.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
24h after electroporation, total RNA was extracted using the RNeasy Maxi kit (Qiagen; cat. no. 75162), followed by polyA+ RNA isolation using Invitrogen Dynabeads Oligo(dT)25 (scaling up the manufacturer s protocol accordingly; cat. no. 61005) and DNase treatment with Ambion Turbo DNase (cat. no. AM2239) at a concentration of at most 200 ng/ l for 45 minutes (min) at 37C. The reactions were then subjected to cleanup with Beckman-Coulter AMPure XP beads (Product No: A63881), at a ratio of 1:1.8. STARR-seq transcripts were specifically reverse transcribed using a gene specific primer (CTCATCAATGTATCTTATCATGTCTG), followed by RNaseA digest. After second strand synthesis (primer: TTGGTAAAGCCACCATGGAAAAG*G) we introduced a 10 bp unique molecular identifier (UMI) at the 3' end of the STARR-seq transcript (primer: CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNGTGACTGGAGTTCAGACGTGT*G), followed by a PCR step across the spliced intron junction of the mature STARR-seq transcript (primers: AAGCCACCATGGAAAAG*G*C*C*A*T and CAAGCAGAAGACGGCATACG*A). Samples were amplified for Illumina sequencing with an Illumina i5 adapter and a custom i7 index primer (CAAGCAGAAGACGGCATACGAGA*T). All PCR steps were performed using the KAPA HiFi HotStart ReadyMix (Roche; Material Number 7958927001), and cleaned up with Beckman-Coulter AMPure XP beads (Product No: A63881) at an appropriate ratio. See Neumayr et al., Curr. Protoc. Mol. Biol. 2019 for more details.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
Library strategy: STARR-seq
Paired-end genome-wide UMI-STARR-seq RNA and DNA input reads (36 bp) were mapped to the Drosophila genome (dm3), excluding chromosomes U, Uextra, and the mitochondrial genome, using Bowtie v.1.2.2. Mapping reads with up to three mismatches and a maximal insert size of 2kb were kept. For paired-end RNA reads that mapped to the same positions, we collapsed those that have identical UMIs (10 bp, allowing one mismatch; UMI sequences are in the sequencing read name) to ensure the counting of unique reporter transcripts. We further computationally selected both RNA and input fragments of length 150-250 bp to only capture active sequences derived from short fragments.
After processing the two biological replicates separately, we pooled both replicates for developmental and housekeeping screens for further analyses.
Significantly enriched regions (peaks) were called with an in-house pipeline using read density profiles of STARR-seq and input. We performed hypergeometric tests to assign a p-value to each peak. Enrichment values were corrected within a 95% confidence interval taking into account the number of independent fragments at a single peak summit position.
Peaks that had a hypergeometric p-value <= 0.001 and a corrected enrichment over input greater than 3 were defined as enhancers.
Genome_build: dm3
Supplementary_files_format_and_content: BigWig files contain normalized genome-wide coverage. Plain text files contain enhancer peaks, including the chromosome, the summit position, the enrichment over input at the summit, and the p-value.
|
| |
|
| Submission date |
Sep 10, 2021 |
| Last update date |
Feb 24, 2022 |
| Contact name |
Bernardo P de Almeida |
| E-mail(s) |
bernardo.almeida@imp.ac.at
|
| Organization name |
Research Institute of Molecular Pathology (IMP)
|
| Lab |
Stark Lab
|
| Street address |
Campus-Vienna-Biocenter 1
|
| City |
Wien |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL27609 |
| Series (2) |
| GSE183936 |
DeepSTARR predicts enhancer activity from DNA sequence and enables the de novo design of synthetic enhancers [Drosophila genome-wide UMI-STARR-seq] |
| GSE183939 |
DeepSTARR predicts enhancer activity from DNA sequence and enables the de novo design of synthetic enhancers |
|
| Relations |
| BioSample |
SAMN21390264 |
| SRA |
SRX12136163 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5574552_S2_hk_STARRseq_input.bw |
211.6 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
