|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Oct 11, 2021 |
Title |
rna_pub1_3_b3_s2 |
Sample type |
SRA |
|
|
Source name |
yeast cell
|
Organism |
Saccharomyces cerevisiae |
Characteristics |
strain: pub1delta batch: 3 genotype: MATalpha his3delta1 leu2delta0 lys2delta0 ura3delta0 pub1::KanMX
|
Treatment protocol |
Cells were collected by vacuum filtration, separated from the filter with a plastic scraper and flash frozen in liquid nitrogen in a mortar and ground with a pestle with addition of polysome lysis buffer (20 mM Tris pH 8.0, 140 mM KCl, 1.5 mM MgCl2, 1 mM DTT, 0.1 mg/ml cycloheximide, 1% Triton) with constant addition of liquid nitrogen.
|
Growth protocol |
The cells were grown in YPD (2% glucose, 2% peptone, 1% yeast extract) at 30℃ and 220 rpm to exponential growth stage (OD=0.5-0.6).
|
Extracted molecule |
total RNA |
Extraction protocol |
Cell lysates were clarified by two sequential centrifugation steps - 3000g, 5 minutes, 4℃, and 20000g, 10 minutes, 4℃. Part of the cell lysate was used for mRNA isolation using Oligo(dT) beads. Another part was treated with ribonuclease I for polysome disassembly and applied to a linear 10-50% sucrose gradient in fractionation buffer (20 mM Tris pH 8.0, 140 mM KCl, 15 mM MgCl2, 1 mM DTT, 0.1 mg/ml cycloheximide, 1% Triton) and separated on a SW-41 rotor (Beckman) at 35000 rpm, 3 hours, 4℃. Subsequently, ribosome-bound RNA fragments were collected from the monosome fraction. Ribosome-bound RNA was isolated using acidic-phenol extraction. cDNA libraries for Ribo-Seq and RNA-Seq were constructed in parallel using standard ribosomal profiling library construction protocol (described in Kasari et al., 2019 DOI: 10.1093/nar/gkz600). Importantly, cycloheximide was added to the lysis buffer but not to the growth media.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
NextSeq 550 |
|
|
Description |
Total RNA
|
Data processing |
Reads were trimmed using cutadapt v. 2.10 with the following parameters for RNA-Seq (-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --minimum-length 20 -q 20) and Ribo-Seq samples (-a CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --trimmed-only -q 20). Additionally for Ribo-Seq, the reads were deduplicated with seqkit rmdup v. 0.10.1, and unique barcodes were then removed with cutadapt v. 2.10 (-q 20 --minimum-length 20 -u -4). Afterwards, reads were aligned against eukaryotic rRNA sequence set obtained from silva-euk and rfam databases using bowtie2 v. 1.2.3. Only unmapped non-rRNA reads were saved for the further analysis. Read mapping and counting against the Saccharomyces_cerevisiae.R64-1-1.95 (Ensembl) genome assembly was performed with STAR v. 2.7.9a. Genome_build: Ensembl Saccharomyces_cerevisiae.R64-1-1.95 (genome-build-accession GCA_000146045.2) Supplementary_files_format_and_content: Tab-separated text files containing read counts per gene as estimated by STAR.
|
|
|
Submission date |
Oct 04, 2021 |
Last update date |
Oct 12, 2021 |
Contact name |
Sergey E. Dmitriev |
E-mail(s) |
sergey.dmitriev@belozersky.msu.ru
|
Phone |
+79032220066
|
Organization name |
Lomonosov Moscow State University
|
Street address |
Leninskie Gory, 1
|
City |
Moscow |
ZIP/Postal code |
119991 |
Country |
Russia |
|
|
Platform ID |
GPL26302 |
Series (1) |
GSE185286 |
RNA Sequencing and Ribosome profiling of GIR2 and PUB1 knockout yeast strains. |
|
Relations |
BioSample |
SAMN22045109 |
SRA |
SRX12485369 |
Supplementary file |
Size |
Download |
File type/resource |
GSM5610134_rna_pub1_3_b3_s2.tsv.gz |
44.0 Kb |
(ftp)(http) |
TSV |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|