|
| Status |
Public on Dec 10, 2021 |
| Title |
Colon DSS day14 B cell depleted (BCD) |
| Sample type |
SRA |
| |
|
| Source name |
Colon
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6J
Sex: female
tissue: colon
genotype: wild type
|
| Treatment protocol |
Wild type C57BL/6J mice were exposed to DSS in drinking water for 7 days and then allowed to recover for 7 more days.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Mouse colonic tissues were collected either on day 0 (without any exposure to DSS) or on day14 after exposure to DSS, Swisrolled and frozen in OCT. Mouse colonic tissues (day0 and day14) were cryo-sectioned (10uM) and placed on the already barcoded spots (6.5mm x 6.5mm) on the glass slide.
RNA libraries were prepared for sequencing following the 10x Genomics Visium protocol
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Library strategy: Spatial Transcriptomics (Visium)
bcl2fastq command line tool was used for base calling
Sequence reads were trimmed for adapter sequence (Template Switch Oligo) and polyA homopolymers using cutadapt (-g XAAGCAGTGGTATCAACGCAGAGTACATGGG;max_error_rate=0.1 -a AAAAAAAAAA ;max_error_rate=0--overlap 5 -n 2)
Reads were mapped, annotated and demultiplexed using the spaceranger v1.0.0 command line tool
Annotated reads were quantified and mapped to the Hematoxylin and Eosin image using the spaceranger v1.0.0 command line tool
Genome_build: mm10 (Ensembl 93)
Supplementary_files_format_and_content: Matrix with raw counts for every gene and every spot
Supplementary_files_format_and_content: Matrix with raw counts for every gene and every spot, filtered to include spots under tissue
Supplementary_files_format_and_content: Hematoxylin and Eosin (HE) image in TIF format
Supplementary_files_format_and_content: Low resolution Hematoxylin and Eosin (HE) image in PNG format
Supplementary_files_format_and_content: Scalefactors in json format
Supplementary_files_format_and_content: Table with array and pixel coordinates
|
| |
|
| Submission date |
Dec 09, 2021 |
| Last update date |
Dec 10, 2021 |
| Contact name |
Ludvig Ale Larsson |
| E-mail(s) |
ludvig.larsson@scilifelab.se
|
| Phone |
+46739911122
|
| Organization name |
SciLifeLab
|
| Department |
Gene Technology
|
| Street address |
Tomtebodavägen 23A
|
| City |
Solna |
| State/province |
Stockholm |
| ZIP/Postal code |
17165 |
| Country |
Sweden |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE190595 |
10X Visium Spatial transcriptomics of murine colon at d14 (mucosa healing) in B cell sufficient/deficient mice |
|
| Relations |
| BioSample |
SAMN23829123 |
| SRA |
SRX13367274 |
