|
| Status |
Public on Aug 02, 2012 |
| Title |
small RNAs from the nuclei of vegetative cells_SL166 |
| Sample type |
SRA |
| |
|
| Source name |
nuclei from vegetative cells
|
| Organism |
Chlamydomonas reinhardtii |
| Characteristics |
strain: cw15_325arg
3prime adaptor: TCGTATGCCGTCTTCTGCTTGT
|
| Treatment protocol |
Small RNAs were isolated from different strains of Chlamydomonas and from cells at different phases of the Chlamydomonas sexual cycle. Genomic DNA was isolated from vegetative cells.
|
| Growth protocol |
Chlamydomonas cells were grown in liquid culture.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted using Trizol (Invitrogen) and small RNA isolated from the total RNA fraction using mirVana (Ambion), adapter sequences appropriate Illumina sequencing were ligated.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Data processing |
Sequence reads were obtained using the Illumina Genome Analyzer Pipeline. The 3 prime adaptor sequence was removed from the small RNA reads and the reads were aligned to the Chlamydomonas genome, assembly 4. Only reads with 100% match to the genome were retained.
|
| |
|
| Submission date |
Aug 02, 2010 |
| Last update date |
May 15, 2019 |
| Contact name |
Krys Kelly |
| Organization name |
University of Cambridge
|
| Department |
Plant Sciences
|
| Lab |
Baulcombe Group
|
| Street address |
Downing Street
|
| City |
Cambridge |
| ZIP/Postal code |
CB2 3EA |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL9152 |
| Series (1) |
| GSE23379 |
Small RNA profiling of strains and lifecycle of Chlamydomonas reinhardtii |
|
| Relations |
| SRA |
SRX025309 |
| BioSample |
SAMN00027527 |
