 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 17, 2022 |
| Title |
SRR5855215_wt_E12_PFL_H3K27ac |
| Sample type |
SRA |
| |
|
| Source name |
proximal forelimb
|
| Organism |
Mus musculus |
| Characteristics |
tissue: proximal forelimb
genotype: wild type
strain: B6CBAF1
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
see original publication
see original publication
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Reanalysis of GSM2713704
|
| Data processing |
All command lines are available at https://github.com/lldelisle/scriptsForBoltEtAl2022
Adapter sequences and bad quality bases were removed with Cutadapt[Martin et al. 2016] version 1.16 with options -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -q 30 -m 15 (−A being used only in PE data sets).
Reads were mapped with bowtie[Langmead et al. 2012] 2.4.1 with default parameters on mm10.
Alignments with a mapping quality below 30, as well as discordant pairs for PE datasets, were discarded with samtools view version 1.8 [Li et al. 2009 and Li et al. 2011].
Coverage and peak calling were computed by macs2 [Zhang et al.2008] version 2.1.1.20160309 with options --bdg --call-summits --gsize '1870000000', and -f BAMPE for PE.
Genome_build: mm10
Supplementary_files_format_and_content: bigwig: coverage from macs2
Supplementary_files_format_and_content: narrowPeak: peaks from macs2
|
| |
|
| Submission date |
Jan 20, 2022 |
| Last update date |
May 18, 2022 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE194111 |
Context-dependent enhancer function revealed by targeted inter-TAD relocation [ChIP-seq] |
| GSE194114 |
Context-dependent enhancer function revealed by targeted inter-TAD relocation |
|
| Relations |
| Reanalysis of |
GSM2713704 |
| BioSample |
SAMN25145256 |
| SRA |
SRX13849967 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5828338_SRR5855215_wt_E12_PFL_H3K27ac.bw |
941.5 Mb |
(ftp)(http) |
BW |
| GSM5828338_SRR5855215_wt_E12_PFL_H3K27ac.narrowPeak.gz |
2.3 Mb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
