|
| Status |
Public on Jun 20, 2022 |
| Title |
ChIP_H3K27ac_E125_WP_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
whisker pad
|
| Organism |
Mus musculus |
| Characteristics |
developmental stage: E12.5
strain: CD1
genotype: WT
chip antibody: H3K27ac Diagenode #C15410196
|
| Treatment protocol |
dissection: Approximately twenty pairs of whisker pads were micro-dissected from E12.5 embryos.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
ChIP-seq experiments were performed as described in (RodrÃguez-Carballo et al 2017).
ChIP-seq libraries were prepared as described in (RodrÃguez-Carballo et al 2017).
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
ChIP
|
| Data processing |
All scripts are available on https://gitlab.unige.ch/Aurelie.Hintermann/hintermannetal2022
TruSeq adapters were removed from single-reads fastqs with cutadapt version 1.16 (Martin 2011 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -q 30 -m 15).
Filtered reads were mapped to the mouse genome mm10 with bowtie2 version 2.3.5 (Langmead et al. 2012 with default options). Only alignments with a mapping quality above 30 were kept (samtools version 1.9 Danecek et al. 2021).
Normalization was done by subsampling filtered reads with samtools view to the lowest number of reads among samples of one species, which is 42317564 for mouse and 22886295 for chicken.
Peak calling was run with a fixed fragment size of 200bp with macs2 callpeak version 2.1.1.20160309 (--call-summits --nomodel --extsize 200 -B).
Genome_build: mm10
Genome_build: galGal6
Supplementary_files_format_and_content: bigwig: normalized coverage track, when multiple biological replicates were done, the average was done
Supplementary_files_format_and_content: narrowPeak: narrowPeak from macs2
All scripts are available on https://gitlab.unige.ch/Aurelie.Hintermann/hintermannetal2022
TruSeq adapters were removed from single-reads fastqs with cutadapt version 1.16 (Martin 2011 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -q 30 -m 15).
Filtered reads were mapped to the mouse genome mm10 with bowtie2 version 2.3.5 (Langmead et al. 2012 with default options). Only alignments with a mapping quality above 30 were kept (samtools version 1.9 Danecek et al. 2021).
Normalization was done by subsampling filtered reads with samtools view to the lowest number of reads among samples of one species, which is 42317564 for mouse and 22886295 for chicken.
Peak calling was run with a fixed fragment size of 200bp with macs2 callpeak version 2.1.1.20160309 (--call-summits --nomodel --extsize 200 -B).
Open H3K27ac peaks were obtained by the intersection of H3K27ac peaks with ATAC peak regions in matching tissues, using betdtools intersect.
Conserved non-coding open H3K27ac peaks were obtained by the intersection of open H3K27ac peaks with conserved non-coding elements using betdtools intersect.
processed data files format and content: "OL_ATAC" narrowPeak: open H3K27ac peaks
processed data files format and content: "OL_ATAC_OL_CNEs" narrowPeak: conserved, non-coding and open H3K27ac peaks
|
| |
|
| Submission date |
Jan 25, 2022 |
| Last update date |
Jun 20, 2022 |
| Contact name |
Aurelie Hintermann |
| E-mail(s) |
aur.hin@gmail.com
|
| Organization name |
University of Geneva
|
| Department |
Genetics and Evolution
|
| Street address |
30 quai Ernest-Ansermet
|
| City |
Geneva |
| ZIP/Postal code |
1205 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE194418 |
Developmental and evolutionary comparative analysis of a HoxD regulatory landscape in mammals and birds [ChIP-seq] |
| GSE195592 |
Developmental and evolutionary comparative analysis of a HoxD regulatory landscape in mammals and birds |
|
| Relations |
| BioSample |
SAMN25248174 |
| SRA |
SRX13912593 |
