|
| Status |
Public on Jun 20, 2022 |
| Title |
CHiC E9.5 posterior trunks |
| Sample type |
SRA |
| |
|
| Source name |
posterior trunk
|
| Organism |
Mus musculus |
| Characteristics |
developmental stage: E9.5
strain: B6CBAF1
genotype: WT
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Micro-dissected E9.5 posterior trunks and HH18 posterior trunks were isolated in PBS supplemented with 10% Fetal Calf Serum and dissociated into single cell by collagenase treatment (10 µl of collagenase 50mg/ml (Sigma C9697) at 37º for approximately 15 mn). Samples were cross-linked with 2% formaldehyde (ThermoFisher 28908) for 10 minutes at room temperature and washed three times with PBS containing proteinase inhibitor. After discarding the supernatant cells were stored at -80º. Further processing was performed as described in (Yakushiji-Kaminatsui et al., 2018)
Following the Hi-C protocol, ligated DNA fragments were processed through the Agilent SureSelectXT protocol to enrich for fragments coming from the probe regions chr2:72240000-76840000 (mm9) and chr7:14946000–17870000 (galGal5).
|
| |
|
| Library strategy |
Hi-C |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
Capture Hi-C
|
| Data processing |
All scripts are available on https://gitlab.unige.ch/Aurelie.Hintermann/hintermannetal2022
Raw reads were preprocessed with cutadapt version 1.16 (Martin 2011 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT --minimum-length=15 --pair-filter=any --quality-cutoff=30).
Then hicup version 0.6.1 (Dryden et al. 2014) with bowtie2 version 2.2.6 (Langmead et al. 2012) and samtools 1.2 (Danecek et al. 2021) were used with default parameters.
The pairs with both mates MAPQ30 and in the capture region (chr2:72402000-77000000 (mm10) and chr7:15000000–17000000 (galGal6)) were then loaded to a 5kb (mouse) and 2.5kb (chicken) resolution matrices with cooler version 0.7.4 (Abdennur and Mirny 2020).
The matrices obtained were corrected with hicCorrectMatrix tool version 3.5.3 (Ramirez et al. 2018, Wolff et al. 2018 and Wolff et al. 2020) and cooler balance.
Genome_build: mm10
Genome_build: galGal6
Supplementary_files_format_and_content: validPairs_filtered.csort.gz: valid pairs in juicebox format: Each line is a pair: <readname> <str1> <chr1> <pos1> <frag1> <str2> <chr2> <pos2> <frag2> <mapq1> <mapq2> str = strand (0 for forward, anything else for reverse). Only pairs with both mates MAPQ30 and in the capture region (chr2:72402000-77000000 (mm10) and chr7:15000000–17000000 (galGal6)).
Supplementary_files_format_and_content: raw.cool: raw matrices
Supplementary_files_format_and_content: iced.cool: matrices ICEd normalized
Supplementary_files_format_and_content: domains.bed: TAD calling on Captured region
|
| |
|
| Submission date |
Jan 25, 2022 |
| Last update date |
Jun 20, 2022 |
| Contact name |
Aurelie Hintermann |
| E-mail(s) |
aur.hin@gmail.com
|
| Organization name |
University of Geneva
|
| Department |
Genetics and Evolution
|
| Street address |
30 quai Ernest-Ansermet
|
| City |
Geneva |
| ZIP/Postal code |
1205 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL21103 |
| Series (2) |
| GSE194423 |
Developmental and evolutionary comparative analysis of a HoxD regulatory landscape in mammals and birds [Hi-C] |
| GSE195592 |
Developmental and evolutionary comparative analysis of a HoxD regulatory landscape in mammals and birds |
|
| Relations |
| BioSample |
SAMN25248376 |
| SRA |
SRX13913347 |
