 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 18, 2022 |
| Title |
WFA_2_H |
| Sample type |
SRA |
| |
|
| Source name |
Heart
|
| Organism |
Amazona |
| Characteristics |
tissue: Heart
Sex: m
individual: 2
age: adult
sample type: converted
|
| Treatment protocol |
NA
|
| Growth protocol |
NA
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Reduced representation bisulfite sequencing (RRBS) was performed as described in Klughammer et al., Cell Reports 2015, using 100 ng of genomic DNA for most samples, while occasionally going down to 1 ng for samples with low DNA amounts (Supplementary Table 1). To assess the bisulfite conversion efficiency independent of CpG context, methylated and unmethylated spike-in controls were added at a concentration of 0.1%. For most samples, DNA was digested using the restriction enzymes MspI and TaqI in combination (as opposed to only MspI in the original protocol) in order to increase genome-wide coverage. For certain older samples, only MspI was used
Restriction enzyme digestion was followed by fragment end repair, A-tailing, and adapter ligation. Fi-nally, the libraries were size selected by performing a 0.75× cleanup with AMPure XP beads (Beckman Coulter, A63881) retaining fragments of about 100 bp to 1000 bp length. The amount of effective li-brary was determined by qPCR, and samples were multiplexed in pools of 10 with similar qPCR Ct values. The pools were then subjected to bisulfite conversion, followed by library enrichment with PCR. Enrichment cycles were determined using qPCR and ranged from 6 to 18 (median: 11). After con-firming adequate fragment size distributions on Bioanalyzer High Sensitivity DNA chips (Agilent),
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
Reduced Representation |
| Instrument model |
Illumina HiSeq 3000 |
| |
|
| Description |
WFA_consensus_reference.fa
|
| Data processing |
Sequencing data were processed with illumina2bam-tools v. 1.12
BAM files were converted to fastq format using SamToFastq.jar (picard-tools v1.100) with the INCLUDE_NON_PF_READS parameter set to FALSE (implemented in RefFreeDMA)
All reads were trimmed for adapter sequences and low-quality sequences using trimgalore v0.3.3 with the following command: trim_galore -q 20 --phred33 -a "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" --stringency 1 -e 0.1 --length 16 --output_dir $output_dir $input_fastq.
Reference-free processing (creation of the deduced genomes and processing) was performed using the RefFreeDMA software/pipeline (http://RefFreeDMA.computational-epigenetics.org)
Bisulfite alignment of the RRBS reads to the deduced genomes and to the reference genomes was performed using BSMAP v2.74 with the following command line: bsmap -a $input_fastq -d $ref_genome_fasta -o $output_bam -D C-CGG -w 100 -v 0.08 -r 1 -p 4 -n 0 -S 1 -f 5 –u (implemented in RefFreeDMA).
DNA methylation calling was performed using the biseqMethCalling.py software (Bock, 2010)(implemented in RefFreeDMA).
Genome_build: processed files list contains consensus genomes for each of 580 species
Supplementary_files_format_and_content: Tab-delimited text files include CpG methylation calls for each sample. The columns in the file correspond to thr chromosome, start and end of a CpG region, rationof methylated/non metylated, mean methylation in ‰ and the strand.
|
| |
|
| Submission date |
Feb 01, 2022 |
| Last update date |
Jun 18, 2022 |
| Contact name |
Christoph Bock |
| E-mail(s) |
cbock@cemm.oeaw.ac.at
|
| Organization name |
CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences
|
| Street address |
Lazarettgasse 14
|
| City |
Vienna |
| ZIP/Postal code |
1090 |
| Country |
Austria |
| |
|
| Platform ID |
GPL31509 |
| Series (1) |
| GSE195869 |
Comparative analysis of genome-scale, base-resolution DNA methylation profiles across 580 animal species |
|
| Relations |
| BioSample |
SAMN25560228 |
| SRA |
SRX14011686 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5853808_WFA_2_H_cpgMeth.bed.gz |
13.1 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
| Processed data provided as supplementary file |
|
|
|
|
 |
