|
| Status |
Public on Jun 15, 2023 |
| Title |
Rice IgG control replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
15-day-old seedlings
|
| Organism |
Oryza sativa |
| Characteristics |
rip antibody: Rabbit IgG
variety: Nipponbare
age: 15-day-old
tissue: seedlings
|
| Growth protocol |
Arabidopsis seedlings were grown on 1/2-strength Murashige and Skoog (MS) medium (1/2 MS) with 0.8% sucrose under long-day conditions (16 hr light/8 hr dark) at 21ºC ±2ºC. Oryza sativa L. ssp. japonica cultivar Nipponbare plants were grown on Yoshida solution in a growth chamber under short-day (SD) conditions (10 h light/14 h dark) with a light intensity of 800 mmol m-2 s -1.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Seedlings were homogenized in liquid nitrogen, and RNA was harvested using Trizol reagent. ac4C IVT was spiked-in in a 1:5000 mass ratio. RNA was fragmented and isolated with IgG or ac4C antibody.
RNA libraries were prepared for sequencing using standard Illumina protocols. acRIP-seq libraries were prepared according to Arango, D. et al., Cell, 2018. Briefly, RNA was converted to final cDNA libraries in accordance with a dUTP dependent strand-specific library preparation. Libraries were sequenced on the Illumina Hiseq 4000 platform as single-end 150 bp reads.
acRIP-seq
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
IgG, rep2
|
| Data processing |
Adapters were removed from reads with the AdapterRemoval tool with adapter sequence 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'.
Reads were then mapped against the Arabidopsis (TAIR10) or rice (IRGSP-1.0) genome with STAR (v 2.5.3a).
Assembly: TAIR10 and IRGSP-1.0
Supplementary files format and content: bigwig files were generated using bedGraphToBigWig; Scores represent Counts Per Million mapped reads (CPM); Scores of Input were subtracted from that of IP.
|
| |
|
| Submission date |
Mar 09, 2022 |
| Last update date |
Jun 15, 2023 |
| Contact name |
Chongsheng He |
| E-mail(s) |
chongshenghe@outlook.com
|
| Phone |
+8619198053436
|
| Organization name |
Hunan university
|
| Street address |
27 Tianma road
|
| City |
Changsha |
| State/province |
Hunan |
| ZIP/Postal code |
410082 |
| Country |
China |
| |
|
| Platform ID |
GPL23013 |
| Series (1) |
| GSE198286 |
Transcriptome-wide profiling of RNA N4-cytidine acetylation in Arabidopsis thaliana and Oryza sativa |
|
| Relations |
| BioSample |
SAMN26549851 |
| SRA |
SRX14423894 |
