|
Status |
Public on Jun 15, 2023 |
Title |
Rice Input replicate 2 |
Sample type |
SRA |
|
|
Source name |
15-day-old seedlings
|
Organism |
Oryza sativa |
Characteristics |
rip antibody: none variety: Nipponbare age: 15-day-old tissue: seedlings
|
Growth protocol |
Arabidopsis seedlings were grown on 1/2-strength Murashige and Skoog (MS) medium (1/2 MS) with 0.8% sucrose under long-day conditions (16 hr light/8 hr dark) at 21ºC ±2ºC. Oryza sativa L. ssp. japonica cultivar Nipponbare plants were grown on Yoshida solution in a growth chamber under short-day (SD) conditions (10 h light/14 h dark) with a light intensity of 800 mmol m-2 s -1.
|
Extracted molecule |
total RNA |
Extraction protocol |
Seedlings were homogenized in liquid nitrogen, and RNA was harvested using Trizol reagent. ac4C IVT was spiked-in in a 1:5000 mass ratio. RNA was fragmented and isolated with IgG or ac4C antibody. RNA libraries were prepared for sequencing using standard Illumina protocols. acRIP-seq libraries were prepared according to Arango, D. et al., Cell, 2018. Briefly, RNA was converted to final cDNA libraries in accordance with a dUTP dependent strand-specific library preparation. Libraries were sequenced on the Illumina Hiseq 4000 platform as single-end 150 bp reads. acRIP-seq
|
|
|
Library strategy |
RIP-Seq |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 4000 |
|
|
Description |
Input, rep2
|
Data processing |
Adapters were removed from reads with the AdapterRemoval tool with adapter sequence 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'. Reads were then mapped against the Arabidopsis (TAIR10) or rice (IRGSP-1.0) genome with STAR (v 2.5.3a). Assembly: TAIR10 and IRGSP-1.0 Supplementary files format and content: bigwig files were generated using bedGraphToBigWig; Scores represent Counts Per Million mapped reads (CPM); Scores of Input were subtracted from that of IP.
|
|
|
Submission date |
Mar 09, 2022 |
Last update date |
Jun 15, 2023 |
Contact name |
Chongsheng He |
E-mail(s) |
chongshenghe@outlook.com
|
Phone |
+8619198053436
|
Organization name |
Hunan university
|
Street address |
27 Tianma road
|
City |
Changsha |
State/province |
Hunan |
ZIP/Postal code |
410082 |
Country |
China |
|
|
Platform ID |
GPL23013 |
Series (1) |
GSE198286 |
Transcriptome-wide profiling of RNA N4-cytidine acetylation in Arabidopsis thaliana and Oryza sativa |
|
Relations |
BioSample |
SAMN26549849 |
SRA |
SRX14423896 |