NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5943614 Query DataSets for GSM5943614
Status Public on Jun 15, 2023
Title Rice Input replicate 2
Sample type SRA
 
Source name 15-day-old seedlings
Organism Oryza sativa
Characteristics rip antibody: none
variety: Nipponbare
age: 15-day-old
tissue: seedlings
Growth protocol Arabidopsis seedlings were grown on 1/2-strength Murashige and Skoog (MS) medium (1/2 MS) with 0.8% sucrose under long-day conditions (16 hr light/8 hr dark) at 21ºC ±2ºC. Oryza sativa L. ssp. japonica cultivar Nipponbare plants were grown on Yoshida solution in a growth chamber under short-day (SD) conditions (10 h light/14 h dark) with a light intensity of 800 mmol m-2 s -1.
Extracted molecule total RNA
Extraction protocol Seedlings were homogenized in liquid nitrogen, and RNA was harvested using Trizol reagent. ac4C IVT was spiked-in in a 1:5000 mass ratio. RNA was fragmented and isolated with IgG or ac4C antibody.
RNA libraries were prepared for sequencing using standard Illumina protocols. acRIP-seq libraries were prepared according to Arango, D. et al., Cell, 2018. Briefly, RNA was converted to final cDNA libraries in accordance with a dUTP dependent strand-specific library preparation. Libraries were sequenced on the Illumina Hiseq 4000 platform as single-end 150 bp reads.
acRIP-seq
 
Library strategy RIP-Seq
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 4000
 
Description Input, rep2
Data processing Adapters were removed from reads with the AdapterRemoval tool with adapter sequence 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'.
Reads were then mapped against the Arabidopsis (TAIR10) or rice (IRGSP-1.0) genome with STAR (v 2.5.3a).
Assembly: TAIR10 and IRGSP-1.0
Supplementary files format and content: bigwig files were generated using bedGraphToBigWig; Scores represent Counts Per Million mapped reads (CPM); Scores of Input were subtracted from that of IP.
 
Submission date Mar 09, 2022
Last update date Jun 15, 2023
Contact name Chongsheng He
E-mail(s) chongshenghe@outlook.com
Phone +8619198053436
Organization name Hunan university
Street address 27 Tianma road
City Changsha
State/province Hunan
ZIP/Postal code 410082
Country China
 
Platform ID GPL23013
Series (1)
GSE198286 Transcriptome-wide profiling of RNA N4-cytidine acetylation in Arabidopsis thaliana and Oryza sativa
Relations
BioSample SAMN26549849
SRA SRX14423896

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data not provided for this record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap