|
| Status |
Public on Jun 21, 2023 |
| Title |
inf_BMDMs 12 scRNA-seq |
| Sample type |
SRA |
| |
|
| Source name |
infected BMDMs
|
| Organism |
synthetic construct |
| Characteristics |
time point: 20 hours post infection
|
| Treatment protocol |
LB-grown cultures of WT or each of 24 MIB-tagged SPI-2 mutant strains were pooled into one tube and opsonized with 20% mouse serum for 30 min and washed with PBS. BMDMs were infected with the pool of SPI-2 mutants at MOIs of 2:1 and spun down for 5 min at 400g to synchronize internalization. After 30 min, cells were washed with media containing 50 μg/ml gentamicin to remove S.Tm that were not internalized. Fresh media containing 50 μg/ml gentamicin was then added back to the cells for the duration of infection
|
| Growth protocol |
BMDMs (8x[10^5] cells/well) were plated in non-tissue culture treated six–well plates supplemented with DMEM containing 20% FBS and 25 ng/ml rmM-CSF
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were harvested 20 hours post infection by a PBS wash followed by incubation of 10 min with ice-cold EDTA (5mM) and analyzed by flow cytometry (BD FACS Aria III) under continuous cooling at 4°C. Infected single cells were sorted into twin.tec® PCR plate 384 LoBind® containing 1.2μl of Cel-seq Lysis buffer per each well, placed immediately on dry ice and stored in minus 80.
Single cells were processed for libraries generation according to the Cel-seq protocol (Hashimshony et al., 2016)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina MiniSeq |
| |
|
| Data processing |
Fastq reads were demultiplexed to single cells based on the CEL-Seq barcode located in positions 7-12 of R1.
R2 reads were filtered to contain the GFP sequence preceding the MIB (positions 1-37 of R2; GFP sequence: TGGGATTACACATGGCATGGATGAACTATACAAATAA, for ∆sseJ the sequence is TGGGATCACACATGGCATGGATGAACTATACAAATAA due to mutation in the plasmid during cloning). To account for sequencing errors, 1 mismatch was allowed for the GFP sequence identification.
The sequence of 10 nucleotides following the GFP (positions 38-47 of R2) is the bacterial barcode, i.e., the MIB sequence. In each single-cell, we counted the number of reads that correspond to each bacterial barcode allowing 1 mismatch in the MIB sequence
Using this procedure, we generated a matrix with the counts of each mutant (MIB) in each cell
Supplementary files format and content: Text files include MIB counts table for each mutant in each cell
|
| |
|
| Submission date |
Mar 15, 2022 |
| Last update date |
Jun 21, 2023 |
| Contact name |
Noa Bossel Ben-Moshe |
| Organization name |
Weizmann
|
| Street address |
Hertzl Street
|
| City |
Rehovot |
| ZIP/Postal code |
76100 |
| Country |
Israel |
| |
|
| Platform ID |
GPL26967 |
| Series (2) |
| GSE198724 |
Paired single-cell host profiling with multiplex-tagged bacterial mutants reveals intracellular virulence-immune networks IV |
| GSE198728 |
Paired single-cell host profiling with multiplex-tagged bacterial mutants reveals intracellular virulence-immune networks |
|
| Relations |
| BioSample |
SAMN26680677 |
| SRA |
SRX14470951 |
