 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 20, 2022 |
| Title |
untreated, rep2 |
| Sample type |
SRA |
| |
|
| Source name |
untreated, rep2
|
| Organism |
Escherichia coli |
| Characteristics |
strain: CAG12184
treatment: untreated
|
| Treatment protocol |
Cells were treated with 4 µg/mL ACT when OD600 reached 0.4. At indicated time points, 200 mL of cell culture were harvested by rapid filtration through nitrocellulose membrane with 0.2 mm pores and flash-frozen in liquid nitrogen.
|
| Growth protocol |
CAG12184 were grown at 37 ˚C in SILAC medium (48 mM Na2HPO4, 22 mM KH2PO4, 8 mM NaCl, 19 mM NH4Cl, 2 mM MgSO4, 0.1 mM CaCl2, 0.4% glucose, 40 µg/mL each of Ser, Thr, Val, Phe, Ile, Leu, Tyr, His, Met, Trp, Lys, and Arg).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Frozen cells were mixed with 0.5 mL of Lysis buffer (50 mM Hepes-KOH, 100 mM NaCl, 10 mM MgCl2, 5 mM CaCl2, 0.4% Triton X-100, 0.1% NP-40, 1 mM chloramphenicol, 1 mM PMSF, 50 U/mL DNaseI, pH 7.0) and lysed via mixer milling. Polysomes were digested with MNase (3750 U/1 mg RNA) and purified through a sucrose cushion. RNA was extracted using Direct-zol kit. Ribosome-protected fragment were size selected and converted into a cDNA library for sequencing.
Libraries are prepared as described in (Mohammad and Buskirk, 2019) with modifications.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Data processing |
Library strategy: ribosome profiling
For replicates 1 and 2, pair-end reads were merged using PEAR and adaptor sequences (ATCGT for rep1; AGCTA for rep2) were trimmed from sequencing reads using Cutadapt. Each read is flanked by 2- and 5-nt unique molecular identifiers at the 5ʹ and 3ʹ ends, which are also removed. Raw data files contain the reads that have been demultiplexed and trimmed.
For replicate 3, adaptor sequence (CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTG) was trimmed from sequencing reads using Cutadapt.
Ribosomal RNAs reads were removed by alignment using Bowtie.
Remaining reads were mapped to bacterial genome using Bowtie.
Ribosome density was assigned to 14-nt upstream of the 3’-end of reads using reads with size range 15–45 nt
Assembly: ASM584v2
Supplementary files format and content: Tab-delimited text files include: Column1: strand; Column2: genomic position; Column3: normalizeds ribosome reads (RPM); Column4: counts of ribosome reads.
|
| |
|
| Submission date |
Mar 24, 2022 |
| Last update date |
Jul 22, 2022 |
| Contact name |
Zikun Zhu |
| E-mail(s) |
zzhu@caltech.edu
|
| Organization name |
California Institute of Technology
|
| Department |
CCE
|
| Lab |
Shan
|
| Street address |
1200 E California Blvd
|
| City |
Pasadena |
| State/province |
CA |
| ZIP/Postal code |
91125 |
| Country |
USA |
| |
|
| Platform ID |
GPL32081 |
| Series (1) |
| GSE199360 |
System-wide analyses reveal essential roles of N-terminal protein modification in bacterial physiology |
|
| Relations |
| BioSample |
SAMN26932592 |
| SRA |
SRX14601014 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5971030_untreated_Rep2.txt.gz |
2.7 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
