|
| Status |
Public on Sep 27, 2022 |
| Title |
601_Xl_MNase_XL_(20220324_TB_601_Mnase_XLnuc_Xlink_cntrl_20220317) |
| Sample type |
SRA |
| |
|
| Source name |
MNase-seq of 601 with Xenopus laevis histones, cross-linked
|
| Organism |
synthetic construct |
| Characteristics |
description: DNA from MNase-digested chromatin
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
MNase-extraction_TB2021.pdf
viral DNA
|
| |
|
| Library strategy |
MNase-Seq |
| Library source |
genomic |
| Library selection |
MNase |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Widom 601 3-copy array with 40-bp linkers
|
| Data processing |
Genome_build: Genome_601x3.fasta
1. We used cutadapt 2.9 with parameters "--nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters off 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the trimmed reads to the reference sequence (Marseillevirus marseillvirus strain T19 or Marseillevirus marseillvirus strain G648 or 3 copies of the artificial sequence Widom 601). 3. We extracted properly paired reads from the alignments with bedtools bamtobed to generate a bed file of aligned fragments (Supplementary file fragments.bed.gz). 4. We used bedtools genomecov to make a normalized count bigwig file. Normalized counts are the fraction of counts at each base pair scaled by the size of the reference sequence so that if the scaled counts were uniformly distributed there would be 1 at each position (Supplementary file normalized_counts.bigwig).
|
| |
|
| Submission date |
Apr 01, 2022 |
| Last update date |
Sep 29, 2022 |
| Contact name |
Jorja Henikoff |
| E-mail(s) |
jorja@fhcrc.org
|
| Phone |
206-667-4850
|
| Organization name |
Fred Hutchinson Cancer Research Center
|
| Department |
Basic Sciences
|
| Lab |
Henikoff
|
| Street address |
1100 Fairview AV N, A1-162
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98109-1024 |
| Country |
USA |
| |
|
| Platform ID |
GPL19424 |
| Series (1) |
| GSE193224 |
A giant virus genome is densely packaged by stable nucleosomes |
|
| Relations |
| BioSample |
SAMN27183536 |
| SRA |
SRX14697312 |
